Transcript asmbl_5494

Sequence
Transcript Sequence for observation asmbl_5494 of TGE0006556:
CTGCAGCTGAAGGCTTCCCCTCCGTCAGTGACAGAGCCTTCGGGTGCGTGATCACTTGTGGTTCTGCACCTCGCGCGTTGGCAGGTAAATTAACATGATGGATTTCTCCAAGCTACCCAAAATACTCGATGAAGATAAAGAAAGCACATTTGGTTATGTGCATGGGGTCTCAGGACCTGTCGTTACCGCCTGTGACATGGCAGGTGCAGCTATGTATGAGCTGGTGAGAGTGGGCCACAGCGAGTTAGTTGGAGAGATTATCCGATTGGAGGGGGATATGGCTACTATCCAAGTGTATGAAGAAACCTCTGGTGTGTCTGTCGGAGATCCTGTACTCCGCACTGGTAAACCCCTTTCAGTAGAGCTTGGTCCTGGCATTATGGGAGCCATTTTTGATGGTATTCAAAGACCTTTGTCCGATATCAGCAGTCAGACTCAAAGTATCTACATTCCCCGAGGAGTAAATGTGTCTGCTCTTAGCAGAGATATCAAATGGGATTTTACACCCTGCAAAAATCTACGGGTTGGTAGTCACATCACTGGTGGAGATATTTATGGAATTGTCAATGAGAATTCTCTCATCAGACACAAAATCATGTTACCCCCACGAAACAGAGGAACCGTAACTTATATTGCTCCACCTGGAAATTACGATACCTCTGATGTTGTCTTGGAACTTGAATTTGAAGGTATAAAGGAGAAGTTCAGCATGGTCCAAATATGGCCTGTACGTCAAGTTCGGCCTGTCACTGAGAAGCTGCCGGCTAATCATCCTTTGTTGACTGGCCAGAGAGTCCTCGATGCCCTTTTTCCATGTGTACAGGGAGGAACTACTGCAATCCCTGGGGCTTTTGGATGTGGAAAGACGGTGATATCACAGTCTCTATCCAAGTATTCCAATAGTGATGTAATCATCTATGTAGGATGTGGTGAAAGAGGAAATGAGATGTCTGAAGTCCTTCGTGATTTCCCAGAGCTCACTATGGAAGTTGATGGTAAGGTAGAGTCAATTATGAAGAGGACAGCTTTGGTAGCCAATACCTCCAACATGCCTGTGGCTGCCAGAGAAGCCTCCATTTATACTGGAATTACACTGTCAGAATATTTCCGTGACATGGGCTATAATGTTAGTATGATGGCTGACTCAACCTCTAGATGGGCTGAGGCCCTGAGAGAAATCTCTGGTCGCTTAGCTGAAATGCCTGCAGATAGTGGATATCCTGCATATCTTGGTGCCCGTCTGGCCTCTTTCTATGAGCGAGCAGGCAGGGTGAAATGTCTTGGAAATCCTGAAAGAGAAGGGAGTGTCAGCATTGTAGGAGCAGTTTCTCCACCTGGTGGTGATTTTTCTGACCCAGTTACATCTGCTACTCTTGGTATTGTTCAGGTATTCTGGGGCTTAGATAAGAAACTAGCCCAACGTAAGCATTTCCCCTCTGTTAATTGGCTAATCAGCTACAGCAAGTATATGCGTGCCTTGGATGAGTACTATGACAAACACTTCACAGAATTTGTTCCTCTGAGGACCAAGGCTAAGGAGATTCTGCAGGAAGAGGAAGACCTGGCAGAAATTGTGCAGCTTGTGGGAAAGGCTTCTCTAGCAGAAACAGATAAAATCACTCTGGAGGTAGCCAAACTTATCAAAGATGATTTCCTACAACAAAATGGATATACTCCTTATGACAGGTTCTGCCCATTCTACAAGACAGTAGGGATGCTGTCCAACATGATTGCATTTTATGATATGGCCCGTAGAGCTGTTGAAACCACTGCCCAGAGTGACAATAAAATCACATGGGCCATTATCCGTGAGCACATGGGGGAGATCCTCTATAAACTTTCCTCCATGAAATTCAAGGATCCATTGAAAGATGGTGAGGCAAAGATCAAAGCAGACTATGCACAACTTCTTGAAGATATGCAGAATGCATTCCGTAGCCTTGAAGATTAGAACTGTGATTTCTTTCTTCCTTTTCCTCAGCAAGTTCTCATGTGTGTATATTTTCCTAGATCTCATCTCAGACCCTTTGCTTTTTTATTGTGCAGCTTTGAGATTCGTGCCTATATGTGTTATCATTTCTTTTCCGGTTTATTTGGTAGGTCTTATATAAAGCAAACATTCCTTTGTTCCAGTGTTTGAAGGGCCTCCTTGATCCTTTCTCCAAAGTGGTGAATGTAGTAAATATGATATACTCTGGCTACACTACTGTAAACTTGTGTGTAGAGTCATGTCCCTCCTTGTCCTAGGTTTGCCCTTTCCTTATCGCCATTACATTGTAAACAGGACTACTGCATGTACTTTGCAACAGATTTGGAATGAAAGGCCAGATTTCTATACATTTTGCCAGGTACTTTATAAAGTGACTTGATATCTATCTACATGTCAAGGTTATTTGCAGTTTAGCATTTTACTAAGTAACTGCTTTGCAGGAAATGTTTGCTTTTTTAAAAAAGATGAATGATTAACGTTCCAATTATGCATTGCTTCCCCACTATATATCAGGAATATTTATGGGAAACTGTTGGGGACTATACTGTTTTTAAAAGTCTTTTGTGGGGACTCAGCACAATATATGAATCAGTACCCTCTAAAAAAGTAAAAAAAAGGGGTCAGATGGTCAAATTTAGATTAATGTCATCTTGTTAAACCTTATTTTGTTTCACTAGGAAAATTTCAGTATCAAGGAATAGTCTACCGCATTACTAGGAAATTCTCTTTTAAATTACATTTAGAACAATCACTGAAAACTTAATCCACATCATATCCTTTTCCTTAAACATCTTAGAAGCTTAAGCTTCTAAGAATCATGTGGCAGCGTGATGGGCAATAAAATGTCACAAAGAAGATATTTATTAATGGTTAAAGGCTCTTTGCACCTTTAAGGACCAGCTGAGCTGTACTGATTCTTGGGGCCAGAGTGGCATTATGTTTTTACAAAATGACATGTGTCACATGTTTGCATGTTTGTTCACTTATTGAATTTTTGAACAAGCAGTTTACCAATTGTAGACGTAATATTTTCTTTCATGTGGGTTTTGATTCACTGGCTCAAGAGTTCTCAGAATATCTGTAGCCATAGCAGCTTACCAGTTTCCATTTGGTTTAATAGGGATAAATTAATTTTTGTGTCTGCTGATGGCAGAATCTAGGTCATGTGAAGAAAGATTATTTCGTCCTATCTTTGAAGTATATATTTTAAAATAGTAGTTTCAGTGTTTGTACAATAAGGTACACTGCAGAACAGCTTTGAGAGCAACAGTTTCCCATTAACTTTTTCTGACCCATAGTGCTGGCATCATCGCTTCCTCTTTGGGAAGAGGAAGGGTGTTGAACATATCTAACAATCTCAAATACCTAAATATAATAGCATAAATAAAGTATTTATTTTATGCTTCAGTATGTTATTATTTAAATTTTTAGGTAATGTATTTCTTTTGGTCTGTTAAGGAAAGATGCAGTCAGAGAATTCAGCTGTAGGTTTTTTTAAATCCTTGCAGGTTGATGCTCTTACTGTGGACTACTATTCAGGACAGAGGTTCTTCCATACAACTTTTTGTAACCTTTCAGAGCACTGGAAGATAAAAATTTTACAATGATCTCTTGAGATGTGAATTTAATGGTGCTGCTTAATCAGTTTGCTTTCAGTGTGGCCTCCTGCCCAGAGATCTTAAGACCAGTGGAAATTAAAAGGATTTAAAAACTTTCTATTTCTACCTTAAACTTACCAGCACACTAGGTGGTGATGAATGATATGACAAAGAAAGCTTGACCAAGTTTGTTTTTTTGTCGTTCCAAATTTGCAGTGTACACTCTTACTCTTTTTTAAGAATGTTGATATATGGGTGTGGAGATGCTAGAGAAACTATGCTCAGATATTCAGTAGAAGTGTTCCTTCAGCTATGTTAAGAATTTCATATTGGTCACTGATCATATTTCTTTAGTAAGAATGTGTTAAAATTACCACAGTCTTTTAAAAAGATGATGCAGTTCTATATTTATTGTGCTGTGCCTGGTCCTAAGTGGAGCCAGTTAAACAAGTTTCATATGTATTTTTCCAGTGTTAAGTGTCACACATTGTACCCTTTGGAAATTTCCTGCCATCCCAAGGAATGAATAGAAGAGACCATATATATTGCCTCCATATCCTTGAGATTTCATTATCTTTATGTTAACAGTTGTGTATAATTGTTAAAATCTATGAAAGAATAAAAAGTGGATTTAAATTAA