Transcript asmbl_54204

Sequence
Transcript Sequence for observation asmbl_54204 of TGE0006453:
AAGTTGTGTCTGTTTTATGGCAATGTACTTTCCGCCTACCTGGAGCTGAATCCTGAGTTTAGGCCTGAGGTAGAGTCGCTGCTTTTTTGGTAAACACCTTTGGAGACTCCTGGGCAACAGGGAGATAATCCCCTATGTTGGGACCATCCCTGAACAGTTGGAGCCTGGAACTTTGATTGTGATCCGTGGGCATGTTCCTGGTGACTCGGACAGATTCCAGGTGGACCTCCAGAATGGCAGCAGTGTGAAGCCTCGGGCTGACGTGGTCTTTCATTTCAACCCACGTTTCAAAAGGTCCAACTGCATTGTTTGCAATACTCTGAAAAATGAGAGATGGGGACGGGAAGAGATCACCTACGACATGCCTTTCAAGAAAGAAAAGTCTTTTGAAATTGTGATTCTGGTGCTGGAAGACAAATTCCAGGTGGCCGTGAATGGGAAGCACGTCCTGCTCTACGCGCACAGGATGCGCCCGGAGGAAGTGGACACACTGGGCATTTACGGCAAAGTGCACATCCACTCTGTGGGCTTCAGCTTCAGCTCGGATTTAGGAAGTACCCAAGCATCTACTCTGGAACTGACAGAGATAAGTAAAGAAAATGCTTCCCAGTGCTGACAGCGGTTTCTTTTCAGACGCTGCCATTTGTCGCAAGGCTGAACTCTTCCATGGGTCCCGGACGGACTGTCGTCATCAAAGGAGAAGTGAACACAAACGCCAAAGGCTTTAATGTCGATCTACTCTCAGGAAAATCGAAGGATATTGCCCTCCACCTGAACCCACGCCTGAACGTTAAAGCATTTGTGAGAAATTCTTTTCTTCAGGAGGCCTGGGGAGAAGAAGAGAGAAATATTACCTGTTTCCCATTTAGTCCTGGGATGTATTTTGAGATGATAATTTATTGTGATGTTAAAGAATTCAAGGTTGCGATAAACGGCGTGCACAGCCTGGAGTACAAACACCGGTTCCTGGAGCTCACCAGTATCGACACGCTGGAAGTCGACGGAGACATCCACTTACTGGAAGTAAGGAGCTGGTAGCTGACGTGAATTGCCTCAAAAACTGAAATACAAAATGGCTTATGTAACACTGGCTTTGTTAAAATGCATCTCAGTATTATCATGTTTATATGTTAAATGAGCTTATAGCAGTTATACTGGGTGTTCCGTCCTAGTAGGTAGTGTGGCTCTGTGAGGCACAGGCGGAAGAAATTTGAAGCAACAGAAGCGTACAGCCATTGCTGAGGCCTTCCTCGCCCCCTGGCCTCGTCTGGAGCCCACTTCCCACTGAACAAGCACTTACGCGGCGCCTGCTCTCACAGCCTCAACGCGCCAAGCACATCCCTTTGCCAGCACCGTGCTGGGGGCCGGGGTGCACGCACGGTGGTGCCCTGGACTGTGCTCCCCGTTCTCTTGAGCTCAGAATCCTGTGTGCTCTGCCCTGTGCACTGTTTCTTCTGCAGGTATCGCATACTCACCAGGGACTTAGAACTGCTCAGCTGTTAAATCACCTAGAAACTAATTCAAAGACAGTACTCTGGCCCCAGTGGTCACACTCAGCGTCATATCTCATAGCTAAGGGGTCGATTTTGACTCCCATCTGGCACTTTCCTTTAGCATAATAAATATCTAGCCCTACTAGCTGTAAGCATTACCAAGTAGTGAACACTATGAAGTCTGAACACAGCACAAAAATTAAGGCAAAAGAATAATCAAGCAAAACAAAAACGAATGTATTGAAATTAACCTGATCTCATTCGCAAGGCCACTGATTTCCGTATCAGTAAATGGTTATTTTAGAACATGTGAATTTAGGTTGAGTCAAAGGTCTGCACGTGCCTCTACAGAAGGTTTAAGGTGGAAGAGGATTTCCATTAGTACAATGTTTATAGGTGACAAAGCATAGCCAAGGTCTGGTTTAATGGCTGCTTCTGAAAGAGGCACGATCGGAAAGTGAAATGCAGCCACTGAGGGCAGGGAGGAGCGTGCGCACCCGTCCTCCGCACGCGAACCAGCACCGCCTCTGCTCTTCCCAGGGATAGTCCATCACGTTAGCGACCGAGATCAAAACATTATTCTACTTTAAGTGATTAAAATCAAACCTGTATCAGCAAGTTAAATTGTTGCGTTCTGTAATTTTTTCTATTCTTTGAAGCGAGTTGGCAGAAATTCTTTGTGGAATTCTTACAGGTCAGATCTTGTTCAAGGAAAATTCAAAGGCTTGGAGTGGGGAGGTAAAAAGCTAAATCAGCCGAATCATTTTATCATATTAAATTGCTGGGCTAGATTCTGCCAGGACTTAGGAGCATTTTCATAACAGGTTTCGGTTAGATACTATTTGTGTCCGTATACGGAAAATGCTATTACTGATCTTGTTTTTAAAAAGTACTCAGCGTAGGAACTTCTAGCACTTGATTCTTTTCCACTTTGTGTTAACTTATTATGCTGAGTTTGCCAAGCTCAAAAAAGACATGGGTGGGAGGGTGTTTGAGAAAGTTGTAGAGGACAAGAAGGCTCTAGAATCCCCAGAGTTATTTTTTTCCCTGCATAAAAGAACATCAGATTGCATGACTGGGGTTTTCCTCTCAGTCTTAAACACATTTTCATTTTCGTGATGTAAATGGGAGACATGACTAAGACAGAAGACTGTTTCCTGAGAAAATATAAAATCTTAAGGTGTTTTTTGACGTGAAGCTATTAGCATTTATCTTATCGAAACGTTTCTTGAAGAGAAACGTGCATTTACCATG