Transcript asmbl_53709

Sequence
Transcript Sequence for observation asmbl_53709 of TGE0006430:
GTCAGTCAGTAATGAACCCTCAGAAGATTCTTCTGCCTCATTTCCCCTCCATTCCATCCTTCTTCATCCTGTAGGGCCCTGGGCATTCCAGCCACTGAGTGTGAGTTTGTAGGGAGCTTGCCTGTGATTGTGGTGGGTCGGCTAAAGGTAGCATTGGAGCCACAGCTCTGGGAACTGGGAAAAGTACTTCGCAATGCTGGGCTGTCCCCTGGCTATGTGGACGCTGGGGCAGAGCCAGCCCGGAACCGAATGATCAGCCAGGAAGAGTTTGCCAGGCAGCTGCAGCTCTCTGACCCACAGACCGTAGCTGGTGCCTTTAACTACTTCCAGAAGGATGCCAGCGGTTTGGTGGACTTCCGAGATGTGGCCCTTGCACTGGCAGCTCTGGATGGGAGCAGGGACCTTGAGGAGCTGACTCTCCTGGCCTTTGAGCTCTTCGCCGAGGAGCAAGCAGAGGGACCTGGCCGCCTGCTGTATAGAGACGGCTTCAGCACCATCCTGCACCTGCTGCTTGGGTCACCCCGCCCAGCTGCTGCGACTTTGCATGCTGAGCTGTGCCAGGCGGGATCCGACCAAGGCCTCTCCCTCTGTCAGTTCCAGGACTTCTCCCTCCGTGACCCACTCCACGGGAAGCTCTTCAGCACCTACCTGCGCCCCTCCCAGACACCAAATGCCTCATCCCCAGGCAGCCCCACTGCTCTGGCCAATGGGACTGTGCACGTGCCCAAGCAGAAGGGCGACTGAGCGCCTCCACCTCCCCAGCTCGCATCCAGCCCACAGACTCAGGGCAGCGCCAGGGGCTGACCCTGGGCCTCACGCCCTCTCTGCTCCTGCTTGATTTTTTGTTATTGTTGTTTGTTTTATTAAGTTTGTTTTATTAAGTTGATTTTCACTTTTTGTTTGATTTTTT