Transcript asmbl_53636

Sequence
Transcript Sequence for observation asmbl_53636 of TGE0006414:
GGGGGAGCCGACGTCGCCTCCTGCGCTGGGCTCAGCCTCGCTTCTAATTGGCCACCTTCGGGGCCGCCCTCCTGCGCGCACCAGCCCTGGGTTCCCTCCGCGGTCCGCACTGGTAAAGCTATCCTCTTCCTTCTTGACCCCTGGCGGTTCCTCCCTCCCTTCCTTCCCTCCCGCTGCCGCCGTCGCTTCTGGCACCACTGCTCCCGGAGGAGCCTTCCGGCTGGGTGATGGGGTCTCGGGCCTCCACGTTACTGCGGGATGAAGAGCTCGAAGAGATCAAGAAGGAGACTGGCTTTTCCCACAGTCAGATCACCCGCCTCTACAGCCGGTTCACTAGCCTGGACAAAGGAGAGAACGGGACTCTCAGCCGGGAAGATTTCCAGCGGATTCCAGAACTTGCTATCAACCCATTGGGGGATCGGATCATCAATGCCTTCTTTCCAGAGGGAGAGGACCAGGTAAACTTCCGTGGATTCATGAGAACTCTGGCTCATTTTCGGCCCATTGAGGATAATGAAAAGAGTAAAGATGTGAATGGACCAGAACCACTCAACAGTCGAAGCAACAAACTACACTTTGCTTTTCGACTATATGATTTGGATAAAGACGACAAGATTTCCCGTGATGAGCTGTTACAGGTCCTACGCATGATGGTCGGAGTGAATATCTCAGATGAACAGCTGGGCAGTATTGCAGACAGGACCATCCAGGAGGCTGATCAGGATGGAGACAGTGCCATATCTTTTACAGAATTTGTTAAGGTTTTGGAGAAGGTGGACGTAGAACAGAAAATGAGCATCCGGTTTCTTCACTAAAGGACTGAGATCAAACTGTTTCGTGCTTTCTAGTATTTAAGAACTGGAACCTGAGAATCCTCCTGTCCACCAACCCCACCTCCATTCCATCATTCCCCTTCTCCCTAAGTACCAAGGCTGTTGCATGATAACTCAGATATGTTCTATCAACACAAACCTGCCTTTGGTGTATAAACAGGGCATTATAGAATGGTACACCTGGTCTATATCTGTTCAGTATCATTCACTGGTTATCTCCATTTCTAAATATTCCTAACCCTTCCCCCACCCCGGTTCTGCTACTGAATGCCTCATGTCCATCTAGTCTGAGAAAGTGAGAGAAGGAATTATGCCAAGAACTAACCAGCAAAGCTCTTTCACTGGATGTAGACTATAGCCATGCCACCGTCCCTCCAGCTAGGCTTTGGCATGCTCCTCCATCCTTTTTTGTATGTCCTTTGCTTCCTACTTCTCTTTCACCCAATACACCATTCACTTAGTCTTTGTCTCTCTGCTTTTTATTAAGCTTCAGCCCCCTCTGTTCTATTTGGCACTCCAAGCTATGCCTGTTCAATGAATTTCTGACTTGGCAGGATAGTTTGGTGGTCTGAAGGATTTTAATCTACTGTTACTCTTGAATGGTCTCTGGGATGTTGCCTTTCCAGGAGCTTTTCGATAACAACACTGCTCTCAGAAGAATGAGACCATCTCTTGGTCCCTTGCACTCTGCTGTGTCATCAAAAGGCCGTGGGCTAGAGATGTTCTTCTTGAAAGGTGGTGGCCTTGTTGAGAGATGTAGAGCCAAGTCTTTTCGGTGGCTTGCCCAGATCGCTCTACCTCTGGCTTCTGATTCTCAACATACATACCTACATGGCTACTTTTAATAGTACAGTGTTGTTTTTTCAGAAAATAGCCACATGCTGGCAGGTTGGCTTAGTTTGGGGACACCAATACCACCAGAATGGCTGCCCTGACAGTATGCTTGGGGACTTTCTCGTGGCTTTTTGAACAAGAAGGCTGGGCACCCTAAAAGCCTCACGTATTCCCACCTCTGCAGCATGGTTTATACCTCAGTGTTATGTGCCCTGGAATGTTTCTCACTTCACATTTCTAGGTAGAAAGATTAGTGTTATGGAAGTGCCTAACTATCCCAGTCCAAAAGATTTAAAGATTGTCCTCAGTGTCTTGAAGTTTTGTACAAAATTCTCTATGAATTTTACATTTGGCAAATGTTAATGCTGGAAGCCATAGTCAGCCCTTAATACAGGTCCAAAGCATTGAATGTATTGTATCATTAGCTGCCTAGTTACACTGACTTCCTAGCTCCTCTCAGACCACTGCTAATCCCTTAGAAACGAGGGGTCTGGCATTGGTAGCATAACCTGAGGTGGCATTACAGGCCTTTGCACGAGCCAGAGCAACTTCTCTGCCTAAGTCAGCTAAATGTAGACCTCATTGAATCAGGCTGTTGTCCTAATGTTGGTCATTTATGAGTCTGTTCATTCTTATATCTGCCCTTAGCTGATTTTCTGACTCATTGCTTGCTGGCTTGTTTCCTTGCTTTGGAAGGCTATCCAAGATGTATACACAATACTTTCAGAAGGGAACTGCTAAAACAAAAAACACCACAAAGGGATTGGAAAGAGGGGAACAGAGCAGTAGTCAGGCTAGATAACTTAAGTATAAATGACTGAGGAATTCTTGATGAAGTATCAGTCTGACTTTGTGATCAAATGATATAATATAGGAATTGTGTAAAGGGAAGAATAATCTGACATTGATTTGTTAGAGAAGTACTTCAAAGGCTCCTTGACTTGCATATTTAAAATTCCTAAGATTATGGCTTTTTCTTCCCTTTGGCTGTATAGCAAACTGTTTTAATCCACAGTTGTGCCTTATCGTTCCATTAAAACTGTATTCTATCCATCAATAAACACTTGTGGTTAAAACAA