Transcript asmbl_53346

Sequence
Transcript Sequence for observation asmbl_53346 of TGE0006368:
CGGGGAAGGGAGGAAGGAAACGAGCGAGGGGGAGGGAGGTCCCTGTTTTGGCGGAGCTGAGAGCGTTGCCGTCCTCTGAAGTGGAGCGAGAGGGAGGTGCTTTGCCGTTTCTCCTGCCGGGGGTCCCGGCTTCCCGTGGAGGCTCCGGATCAAACCCCTTCAGCTTCTCCCTCCGGATCGATGTGCTGCTGTTAACCCGTGAGGAGGCGGCGGCAGCGGAAGATGGTGTTGCTGAGAGTGTTAATTCTGCTCCTCTCCTGGGCGGCGGGGCTGGGAGGTCAGTATGGAAATCCTTTAACTAAATACATTAGACATTATGAAGGATTATCTTATGATGTGGATTCATTTCACCAAAAACACCAGCGTGCCAAAAGAGCAGTCTCACATGAGGACCAGTTTTTACGTCTAGATTTTCATGCTCATGGAAGACATTTCAACCTACGAATGAAGAGGGACACTTCCCTTTTTAGTGATGAATTTAAAGTAGAAACATCAAATACAGTACTTGATTATGATACCTCTCATATTTACACTGGACATATTTATGGTGAAGAAGGAAGTTTTAGCCATGGGTCTGTTATTGATGGAAGATTTGAAGGATTCATCCAGACTCATGGTGGCACATTTTATGTTGAGCCAGCAGAGAGATATATTAAAGACCGAAGTCTGCCTTTTCACTCTGTCATTTATCATGAAGATGATATAAACTATCCCCATAAATATGGTCCACAGGGGGGCTGTGCAGATCATTCAGTATTTGAAAGGATGAGGAAATACCAGATGACTGGTGTAGAGGAAGTAACACAGAAACATAAAGAAGAACATGCCGTTAATGGTCCAGAACTTTTGAGGAAAAAACGTACAACTTCAGCTGAAAAAAATACTTGTCAGCTTTATATTCAGACTGATCATCTGTTCTTTAAATATTATGGAACACGAGAAGCTGTGATTGCCCAGATATCCAGTCATGTTAAAGCGATCGATACAATTTATCAGACCACAGACTTCTCCGGAATCCGTAATATCAGTTTCATGGTGAAACGCATAAGAATCAATACAACTACTGATGAGAAGGACCCAACAAATCCTTTCCGTTTTCCAAATATCGGTGTGGAGAAGTTTCTGGAATTGAATTCTGAACAGAATCATGATGACTACTGTTTGGCCTATGTCTTCACCGACCGAGATTTTGATGATGGCGTTCTTGGTCTGGCTTGGGTTGGAGCACCTTCAGGAAGCTCTGGAGGAATATGTGAAAAAAGTAAGCTCTATTCAGATGGTAAGAAGAAGTCCTTAAACACTGGAATTATTACTGTGCAGAACTATGGGTCTCATGTACCCCCCAAAGTCTCTCACATTACTTTTGCTCATGAGGTTGGACATAACTTTGGATCTCCACATGATTCTGGAACAGAGTGCACTCCAGGAGAATCTAAGAATTTAGGGCAAAAAGAAAATGGCAATTACATCATGTATGCAAGAGCAACATCTGGGGACAAACTTAACAACAATAAATTCTCACTCTGTAGTATAAGAAATATAAGCCAAGTTCTTGAGAAGAAGAGAAACAACTGCTTTGTTGAATCTGGCCAACCTATTTGTGGAAATGGAATGGTAGAGCAAGGTGAAGAATGTGATTGTGGCTATAGTGACCAGTGTAAAGATGAGTGCTGCTATGATGCGAATCAGCCAGAGGGGAAAAAATGCAAGCTGAAACCCGGAAAACAGTGCAGTCCAAGTCAAGGTCCCTGTTGTACAGCACAGTGTGCATTCAAGTCAAAAACTGAAAAGTGTCGGGATGATTCAGACTGTGCAAAGGAAGGAATATGTAATGGCATTACAGCTCTCTGCCCAGCATCTGACCCTAAACCAAATTTTACAGACTGTAATAGACATACACAAGTGTGCATTAATGGACAATGTGCAGGTTCTATCTGTGAAAAATATGGCTTGGAGGAGTGTACTTGTGCCAGTTCTGATGGCAAAGATGATAAGGAATTATGCCATGTCTGCTGTATGAAGAAGATGGACCTATCAACTTGTGCCAGTACAGGGTCTGTGCAGTGGAGCAAGCAATTCATGGGTCGAACCATCACACTACAACCTGGATCCCCGTGCAATGATTTTAGAGGCTACTGTGATGTTTTCATGCGTTGCAGATTAGTAGATGCTGATGGTCCTCTAGCTAGGCTTAAAAAAGCAATTTTTAGTCCAGAGCTCTATGAAAACATTGCTGAATGGATTGTGGTTAATTGGTGGGCAGTATTACTTATGGGAATTGCCCTGATCATGTTAATGGCTGGATTTATTAAGATATGCAGTGTTCATACTCCAAGTAGTAATCCAAAGTTGCCTCCTCCTAAACCTCTTCCAGGCACTTTAAAGAGGAGGAGACCGCCACAGCCCATTCAGCAACCCCAGCGTCAGAGGCCCCGGGAGAGTTATCAAATGGGACACATGAGACGTTAACTGCAGCTTTTGCCTTGGTTCTTCCTAGTGCCTACAATGGGAAAACTTCACTCCAAAGAGACACCTATTAAATCATCCCCAAACTAAACCCTTACAACTAACAGAAGAAAAAAAAAATGGCAAGAGATCATGTCCTCAGACCAGGTGGAATTAATTAAATTTTAAAGCCTGAAAATTCCAATTTGGGGGTGGGGGGTGGAAAGGAACCCAGTTTTCTTATGGACAGATATTTTTAACCTAATGGCACAAAGTCTTAGGATATTATTATGTGCCCCGTGTTCCCTGTTCTTCGTTGCTGCATTTTCTTCACTTGCAGGCAAACTTGGCTCTGGATAAACTTTTATCACAAATTGAAATATATATATATTTTTTTCAACTGCCAGTCAAGGCTAGGAGGCTCAACCACCTCAGCATTGGAGACATCACTTGCCAATGTACATACCTTGTTATATGCAGACATGTATTTCTTACGTACACTGTACTTCTGTGTGCAATTGTAAACAGAAATTGCAATATGGATGTTCCTTTGTATTATAAAATTTTTCTGCTCTTAATGAAAAATTACTGTTTAATTGACATACTCAGGATAACAGAGAATGGTGGTATTCAGTGGTCCAGGATTCTGTAATGCTTTACACAGGCAGTTTTGAAATGAGAATCAATTTACCTTTTTCTTATGATGGAATTGGTTCTGATATTCATTTTGTCTTTATCAAATGGCTGCTAAGAGCACATGAGTGACTTCGCTGAAGAACACAAGTGTTGTGCAAACTGGACATATGCAGCATACTACTTCAGAGTTAGTTCTTTATGTAAGTGTCTGATTTCTGCTTACTTGTTTTAGACTTTCTAACTCAATTCCAGTTTTGAATTGATAGGTAAAATTTTATTCATGCTTTGGTAGAAATTATGTCAATGAAATGATTCTTTTTATTTGTAACCTCTTATTTGTTTTTTCCATATATCTAAAGTATGCTAATTATGTTTTTGGTTTTTGTGTGATATGGAAAAGAAAAGCTGTGTCTTTATTTTATCAAAATATTTGAACATTTTTTTCAGCATATCATCACTGATCATTGTTAACCACTAAAGAGTGATTTGCTCTACTTGTAGTTAAAATTGTAGGATAGGCCTTCTGACCTTTTTTCCCCTGAAATATTTTAACAACAATGGAGTTGAAACAGCACAATGTCCCATTCCAAATTTATTTTGTAAACAGATGTAAATAATTGGCTTTTTAAAGAAAGAAAGCAAAAGCATTTAATGTATTAACAGGCTTATTGCTATGCAGGAATGGAAGGGGGCATTACAAGAAAATTTTAAGCTTGTGACATATTTATTACTTGTTTTCCAGCTACATCACTTAAATGAGATGTAAACAGCTATGATTTTCCTGGCTTCACATAGGAGGCAAATTTAGGGAAAGTTGAAAAAAAGTCTGTGTTTTGGCTTCTTTTTTTCCTTTTTTTTCTTAAGAGTATAAGGTTTACACAATCATTCTCATAATGTGACGCAAGCCAGCAAGGCCAAAAATGCTAGAGAAAATAATGGGATCTCTTCCTTGTAAACTTGTACAGTATGTGGTGACTTTTTTCAGAATACAGCTTTTTGTACATGATTTAGAGACAAATTTTGTACATGAAACCCCAGATAGACTATAAATAATTCTAAACAAACAAGTAGGTAGATATGTATGTAATTGCTTTTAAATCATTTAAATGCCTTTGTTTTTGGACTGTGCAAAGGTTGGAAGTGGATTTGCATTTCTAAAATGGTGACTTTTATTCTGCAAGAGTTCTTAGTAACTTCTTGAGTGTGGTAGACTTTGGAACATGTACATTTTTTGCTTGTAATGTTATCCTGTGGTAGGGTTTTGGCAGGTACACACTGCCCTATTTTATTTTGAGTCTAAGTTAAATGTTTTCTGAAAAGAGATACGTGCACTGAACTCTCCACGGCAAATCAAGATGTGGTAAAACAAAAGGATCAAGACAAATGAGATCTAATACTACTGTCAGTTTAATGTCCACTGTGTTTTATACAGTATCTTTTTGTTCACTTTGGAAATTTTTACTAAAAATTGCAAAAAATAAAGTATTGTGCAAAGATGTAAGGTTTTTTGAAACTTGAAATGCATTAATAAATAGACTTGATGAAATCAA