Transcript asmbl_51914

Sequence
Transcript Sequence for observation asmbl_51914 of TGE0006305:
AGGTTATCCTGAATACCACATGTCTAATACTTTCCCTTGCAACGTTAGCCAGTGTTTTTCACTGCCTCCAAAAGATTGAAATTGCTCTGGAAATTGGAAACATTTGATTTAAACGAAATAACGTTAACAAATGGACAATATGTCTATTACAAATACACCAACAAGTAATGATGCCTGTCTGAGCATTGTACATAGTTTGATGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATTGAAAGTTTGGTGAAGAAACTGAAGGAGAAAAAGGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGCAAATGTGTTACCATACAGAGAACATTGGATGGAAGGCTTCAGGTTGCCGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGGTGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGACAGTGTCTGTGTGAATCCATATCACTATGAACGAGTTGTATCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCACCAAGTATGTTGGTGAAGGATGAATATGTTCATGACTTCGAGGGACAGCCATCGTTATCCACCGAAGGGCATTCAATTCAAACCATCCAACATCCACCAAGTAATCGTGCATCAACAGAGACATACAGCACCCCAGCTCTCTTAGCTCCATCTGAGTCTAATGCTACCAGCACCACCAACTTTCCCAACATTCCTGTGGCTTCCACAAGTCAGCCTGCCAGTATACTGGCAGGCAGCCATAGTGAAGGATTGTTGCAGATAGCTTCAGGGCCTCAGCCAGGACAGCAGCAGAATGGATTTACTGGTCAGCCAGCTACTTATCATCATAACAGCACTACCACCTGGACTGGAAGTAGGACTGCACCATACACACCTAATTTGCCTCACCACCAAAACGGCCATCTTCAGCACCACCCGCCTATGCCGCCCCATCCCGGACATTACTGGCCAGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCTAATCATCCTGCTCCTGAGTATTGGTGTTCCATCGCTTACTTTGAAATGGATGTTCAAGTAGGAGAGACATTTAAGGTTCCTTCAAGCTGCCCTATTGTTACTGTTGATGGATACGTGGACCCTTCTGGAGGAGATCGCTTTTGCTTGGGTCAACTCTCCAATGTCCACAGGACAGAAGCCATTGAGAGAGCAAGGTTGCACATAGGCAAAGGTGTGCAGTTGGAATGTAAAGGGGAAGGTGATGTTTGGGTTAGGTGCCTTAGCGACCATGCAGTCTTTGTACAGAGTTACTACTTAGACAGAGAAGCTGGGCGTGCACCTGGAGATGCTGTTCATAAGATCTACCCAAGTGCATATATAAAGGTCTTTGATTTGCGACAGTGTCATCGGCAGATGCAGCAGCAGGCGGCCACTGCACAAGCTGCAGCAGCTGCCCAGGCAGCAGCCGTGGCTGGAAACATCCCTGGCCCAGGATCAGTAGGTGGAATAGCTCCAGCTATCAGTTTGTCAGCTGCTGCTGGAATCGGTGTTGATGACCTTCGTCGCTTATGCATACTCAGGATGAGTTTTGTGAAGGGCTGGGGACCGGATTACCCAAGACAGAGCATCAAAGAAACGCCTTGCTGGATTGAGATTCACTTACACCGGGCTCTCCAGCTCCTAGATGAAGTTCTTCACACCATGCCTATTGCGGACCCACAACCTTTAGACTGAGGTCTTTTACTGTTGGGGCCCATAACATTCTTTGTCAGGATGGTGGACTATAAAATACAATCCTGTTTATAATCTGAAGATATATTTCACTTTCGTTCTGCTTTATCTTTTCATAAAGGGTTGAAAAATATGTTTGCTGCCTTGCTCCTAGCAGACAGAAACTGGATTGAATCAATTTTTTTTCCTATTTAGAACTTTTCAGGCATGGCTCAGAGCTTGAAGATCAGGAAAAACACATTCTTATTAAATCTTCACCAGTTATATATGAAGGAATCATTCCAATGCTGGAAAATTTAGCCCTTTAAACTGTCTTAGACCCTTTTATATGCAGAACATCGATATGTGTGTTATTCTACAGAATAAATTCAATATTGCTGATTTTAAAGGCAGAGAAGCTCTCTAAGTTAATTCACCTATGTTATTTTGTGTGCGAGTTGTTATTGTTGAACATACTTTACTCCCAGGTATTGTGCCATGTGGGTGAGTTAATTTTACCAAGAGCAACTTTACTCTGTGTTTAAAAAATAAGATAGTAATGTATTATAACCTTTTATCCAAAATATTTTTTGCAAGTTAAACTAGTGAAGATGATTTCAATTCAGATTGTCTTACGATTTCAATTTTATTTTCGCCAAGGCAAAACACTAATCTCTGTGTATACTGAGAATTCTTTAAAATTATCAAAGTAATATCATTTAAAATTACACTCGTTATCCCTGTTGGATAACTATTTATCAAGTAGTGTACTTTTGCCCTGTTAAACAGTAGACGTAGTATATATTTCTAGGCACAAGGTTGGTTACTAAGCAGCCTAGAAGAAGAATTTCTTTTTCTTCATTAATTCATAGGGAAAGGTTTTGTATTTTTAAAAACACTAAAAGCAGTGTCACTCCACCTGATAACTTACCATTCTGCAAAGGTGGCAATGCTTAAACTAAATGATGAGTATTTTGGAAACTGCTAAATTCTGTGTTAAATACTGTGCAGAATAATGGAAACATTATAGTTCATAATAGGTAGTTTGGATATTTTTGTACTTAATTTGATGTGTGACTTTTTTTTCATATACTGTTTAAATCATGTATGTTATGACATTGTTTAAAATTCAGTTTTTGTATCTCGGGGCAAGACTGCAAACTTTTTATACCTTTTGGTTATTCTAAGCCCTTTGCCATCAATGATCATATCAATTGGCAGTGACTTTGTATAGAGAATTTAAGTAGAAAAGTTGCAAATGTATTGACTGTACCACAGACACAATATGTATGCTTTTTACTTAGCTAGTAGCATAAATAAAACCAAATCTCAACATAAAAAGTTGAATTCTAGGTTTGATTTTTAAGTTTTTTTTCTTTTGCACTTTTGAGTCCAATCTCAGTGGCAGGACACCTTCTACTAAATGACAGGCAACAGCCAGTACTGCAGCTTTGGTTTTTCCCTTACACTCTACTGGGACTTCCCCATGGACATTATATATCAAGTAAAGAATTGGTTATTTTTTGAACTTTTATTTTACTGTAGCAAAAATAGTCCTGATTGTCTACAAGATAAATAAGTTGTCTACAAGATAAGTAGTTTGAAATAAGATCAAGGATTATCTTTCAGATGCTTTTACTGTTTGTTTGGAAGGCCTTTCTAAGTGTAGTAAGATTCTAAGGTGTGTTACAAGTTTGAGATAATGAGAAGCACTTATGCATGATAGTCATCCTTATATCGACTTAGGTGAACAAGTCTTCAACTTCCTTGCTCTGAAAGTCTTAAGACCACCTAGTAACCACTGAGTTTGCTTATTGCTGTGATTTAAACATAGTTGTTGATTCAAGCTACATGTTTTTTGTTTTTAAAATAACTTCTTT