Transcript asmbl_51501

Sequence
Transcript Sequence for observation asmbl_51501 of TGE0006300:
GAAATAGCAGCGGCGGCGGTTCCGCCCGCGGGCGCCGGGAGGGAAAGGCGGAGACTGGGGAACGCTGGCTCGGCGCGGGCGCGGCCCCGGCCCCGGAGGATGCTGAGCCCCTGCCCGGACCGTCCCGGAGCACATGATGGCGATACGGGAGCTCAAAGTGTGCCTTCTCGGGGACACCGGAGTTGGGAAATCGAGCATTGTGTGCCGGTTTGTCCAGGATCACTTTGACCACAACATCAGCCCGACCATTGGGGCGTCTTTTATGACCAAAACTGTGCCTTGTGGAAATGAACTTCATAAATTCCTCATCTGGGACACTGCTGGTCAGGAACGGTTTCACTCCCTGGCTCCCATGTACTATCGTGGATCTGCTGCAGCTGTCATAGTGTACGACATTACCAAACAGGACTCATTCCACACCTTGAAGAAATGGGTGAAAGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCTATTGCTGGGAACAAATGTGATCTCTCAGATATAAGGGAGGTTCCCTTGAAGGATGCAAAGGAATATGCTGAATCCATAGGTGCCATTGTGGTTGAAACAAGTGCAAAAAATGCTATTAATATCGAAGAGCTCTTTCAAGGAATCAGTCGCCAGATCCCACCCTTGGACCCCCATGAAAATGGAAACAATGGAGCAATGAAGCTTGGGAAGCAAGCTACGCAAGCCAGCCGGCGGTGCTGCTGACCAGGGGTCACGGCCCACTGTACTTGAAGAAGCCAGAGTCACCTCCCCATGCACTGCTGAAGGACCCCCTAATCTTAGTGGCCTGGCGCCTCACTTAGAGAGAAGTGAGCACACTGGCTTGGCATCATGGAAGACCCACAGGGAACGGGGCAGGAAAAGTCCCCGGAAAAGGATTTGAGAAAACTCTGGAAAAATTCACCACGTCGCCTTTTGTGCATGAAATGCACACGGGAGGGAATGGATGTTAGGTAATAAGTATAGTTGAGTTTTTGTTAAACCTTAGAATATTCTCGATTTGTACAAAAATTTTACTGGTTTATTATGTGTGTGAGATTATAAAGTGGTGTTCCACTCTGATTTCCTGTGTTCCCTAGCCAAACTCCAGTAACTTCTTCAGCGCCATTGCTTCTGTTGACTAACCAGCCTTCACTGAAAGGTTAATTTAATTTTATTTAGTTTGCCTTTCACTGGAGCATAATTGGATCATCACTCAAGCTGTGGACTTGAGCTTTTATAAAAGTGGAGAAAGATGTATTAGAAACTGTTGTCAATATCTCCGACTCTTACTTGATGAACATTTTTCCAAGTTTTGATCATTATAAACAAACAAGCCCAATCTGGCTAAAAATATTGCATTTAATTTTGGGAGTGGGAGGCCTAATTTGGAAGAGTCGTTTAAAGTCACTGTATAAGCGGTGACAGATGTAGGACGTAAATATTATTCCAGAGACCATTTGGTATGCATCACCTCCACAGCAATAAATCCCTACTCTCTTAGAGAGGTTTTAATGCACAGAGTATTATTTTACTAAGAATTTGTGATAGTGTCACGTCTAAGGGGGAAATTAACTGGAGGACATTTAAGTCTATATCATAGGGCAAACTTCTAATAGCAGTTAATAACAGGTTACTGCAAAGCCAGCCAAGGGAAGTCCCAGCACCTTAAGATTCTAGACCTCTAACAGCACAATCAGAGAAAGCATTTGAGGAGATGCCAAGCCTGGGGAGGCAGATCTTAGGGCTAATGAGGACTCCAACTTTGGGATGCCAATTAACTGGGACTAGGCTGTGATAAAACCTTCCTTTTCAGGTACCCTGTCTGCTCAATTAATTAAAGATGTCTGACTGCAAAGGCAGTAAAGGGAGAAAAGGCATGAAGAGGAAGAAAAACTATTTCTATTCTAAATTCAAATCCTATTACCATTTTAATTTTCATAAAAACCTGGAAATCAAGAAGCAGTATGAGTGTGTGTGTGTGTGGGGTCCTATTAGGTCTTATATCGGGAGGTGATTCTTAAGATTTGGAATCGTGCCTTTTGTTGGGGTTAAGGAACTGTGACAGAATGGCCTCAGAAATGGTTAATTGTGCAGCATGGTCCAGCCGGTACCTTCTTTGCCATAAATGTTCAGGGGCTGAGAAACATTTATTGAAAATTTACAGTGTTAAAACCAGCAGAGAGATCATCAGCTGATTAAAGACCTCAAACTTTGAGTAACTCATGTGAGCTGGTGCTTCATGTCTTGCCACGACTGTGCCCTCTTTGCTCTTCACATATAGTGACACCGAGTCCCAACAAAAAGAAAGAGTCCTTGAGAGACCAGGGCCAAGTTTACACTTCTCTACATGGACAGTAATCAAGAAAATAGATGGAAATCACAGATTAAGGTGTTTTTGTTTGTTGTTGTTGTTTTAACAAAAGAATACGGTGTCAATTTGATTTTCTTACTTACTGCTTTGCTCAGCTTGCAAGAGTAGTTTGACAACCTTAAAATTTGAAGGCTGGAAACACTTATATTTGGTTCAAGAGTGCCTCTGAGCTCTCCCAGACAAGTACCTCAAAAAATGTTAGCAAGTGGCATTTGGATGTCTTGGTAGAGCTTTTACAGGGGTTTTTAGGGTTATCTCCACATTGTTAACATTACTTGCTAACATGATTCTGCTTGCAGGCCAAGCAATTATCATGCCTCTACAAAGCTCAAAAATTTGGGATGAAAATTGAAATGACATTTTCCAGGTGACATGCAGGCTTATTTTGGAAGCTTTCCTCATCAAGCTGTCCCTGAGAACCTGGGTTTCTCTCTAGACAGCCTCTCAGGTTTCCTAGATAAGGTGGTATGCGTCCCAGTGGAGTTACACAGCTTTAGGCTGGATCTCTAGTGGTTCTGTCTTGTATAAAATGGCTGGTCTTATAAACATGTAGAGAACTACCCACGAATGAGCCCATGGTTTTATTTCAGAAGCACATGAGGGTGTGAAACCACTCTTTTACCTTTCTGTATTGCTTTAACTATTCAAGCCAGTCAGATGACAGTGTATATAATTATTACTACTTGGAGCAACTGGTGAAAAGAGTAGATGGAACTTGGGCACACAAGCCTTCACTTAAACATGGGGTCTTCTCTGAAGACAGATGCTTCAGCCTTGTCCAGGCTTTCTTATCTTTCTTTATTCTGCCTTGAGATTACTTTCTGTTTGTTCTAACAATTGAAGTATAACCAAGTAATACTATGTAATGGCCTGGATATTACTTTTGCTCCAAAATGTCAAGTTGTTTCATGTGATGTAGCATCCTTCACATAATTTCACCAAATTTGCTCCTTTCCCTCTGTTTTCCCCCCCTTTCATGTGCAGTATATGTATATGTGTAAATATGATTTCATATTTGTTATGCCAACATATAATCCGTTTCACTGGCTAAGTTTGGCTCATGACCGTGTGTTATATAATATAGACATGGGTTCTTATTGGGATTATTTCCCAGTGGAAAGCCCTAAGATGGCAGTGGAGTCAGACATTTTATGTAGGTACATAATTGACTTGCCATTTTATAATTGAAAATGGTACACTAGTGTGTTGAATGTGATATTACCTTGTAGCCTATAGAAGATCGAAGACTTAAAACTAACCTTTAGCCAACAAAGAGCTGTGCCCCAATGAAATTTGAATTAATTTTCTGAAGGAGGTTTGGACGACTGAAATATTTCCTCTTAAGATAAAAGAATATGGCATGTGATGGCTACATTGAGCTCCTTTTAGGGGACTCCACTTCTCATTGCTCTGCAATGCTTGTAGTGAGTTGAATAATGAGCTGGCTTATGAAAGAAAGGACTCTGAGCTGTATTCAGACCTGTTAGGTATCGAGTTTACTCTTTTAATCATTATTGTTGGAACCAGACCCAGTGATCCAATGTCAGGGCTCTGTTGTGTAAACCGCTCCTTTCTCTCGTGTTTTTATAAAGGGCTTCTGTCTGGGCTGGACCCAGTTCTCACATATAGAAGATGCCACTGTAGACAGGACCTTTCTACATTGTATTCTGTAGTAAAGCATCGCCACAACATCGCCCAATTGTATCTGTTATTTTTGGTTTAAC