Transcript asmbl_51362

Sequence
Transcript Sequence for observation asmbl_51362 of TGE0000988:
NNNNGGTGTCTCTCTTCGAGTGTGGAATCCTCTGGTTATCGTCGCCATCCTGGTCTCGGGGGCACCGATCTCAGGGTCTTCGGGAGGAGAATTCTTGCCGTTACTGATTTCTCGCTGAAGGCAGTGTCCTATGCAAGGGGACGTTAGGAGCACCCGATTTGGCGCCCTGGGGCCTTGCGGCCTTTGCCGCCCGAAGAGGGGCGCGATGAGCGGGAATGGGGGCTTCAGGGTGACCTCCGAAAATGGTTCGCTATTCACTTGACCCAGAAAACCCCACTAAATCATGCAAATCAAGAGGTTCAAATCTTCGTGTTCACTTTAAGAATACTCGTGAAACTGCCCAGGCCATCAAGGGTATGCATATTCGAAAAGCCACCAAGTATCTGAAGGATGTCACTTTACAGAAGCAATGTGTACCATTCCGTCGTTACAATGGTGGAGTTGGTAGGTGTGCCCAGGCCAAACAGTGGGGCTGGACACAGGGTCGATGGCCTAAAAAGAGTGCTGAATTCTTGCTGCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAGGTGAACAAAGCTCCCAAGATGCGGCGCAGAACTTACAGAGCTCATGGGCGGATTAACCCCTACATGAGCTCTCCTTGCCACATTGAGATGATCCTTACTGAAAAAGAACAGATTGTTCCTAAACCAGAAGAAGAGGTTGCACAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCCCGGGAGTAAATTTAGCATCAAATAAATGCTAGTAAAAGTAAAA