Transcript asmbl_51089

Sequence
Transcript Sequence for observation asmbl_51089 of TGE0001954:
GCGCAGTTGAGAGCAGGGTCTCAGTTCTGCGGCAGTGTGAGTGGATAGAGTGGCGGTGCACTCGTGTTGGCTCTCAAAATCCCCGCGTAGCCACTGTCGCCTTTTCCAGCCCTCGCCATGTTCCTCACCCGGTCTGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATCGAGGCTATCAAGCTTGGTTCTACAGCTATTGGAATCCAGACATCAGAGGGTGTGTGCCTAGCTGTGGAGAAGAGAATTACCTCCCCACTCATGGAGCCAAGCAGCATTGAGAAAATTGTAGAGATTGATGCTCACATAGGTTGTGCCATGAGTGGGCTAATTGCTGACGCTAAGACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACATACAATGAGACAATGACAGTGGAGAGTGTGACCCAGGCTGTGTCCAATCTCGCTCTGCAGTTTGGAGAAGAAGATGCAGACCCGGGTGCCATGTCTCGTCCGTTTGGAGTAGCACTGTTATTTGGAGGAGTTGATGAGAAAGGACCCCAGCTGTTTCATATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCAGAGGGTGCCCAGAGCTCTTTGCAAGAAGTTTACCACAAGTCTATGACACTGAAAGAAGCCATCAAATCTTCACTCATCATCCTCAAACAAGTAATGGAGGAGAAGCTGAATGCAACTAACATAGAGCTAGCCACTGTGCAGCCCGGCCAGAATTTCCACATGTTCACAAAGGAGGAGCTCGAAGAGGTTATCAAGGACATTTAAGGAAGCGTGATCCTCAGAGCTTCTCTGGGACAGTTTCAGTTCTCCTAATTGCCCTTAACTTTTATTTCCAGCTCATATTCCTTGGAAAATCTCCAGTATATGTGCATTTTTTTATGATGTCTGTACATAAAGGCAGTTCTGAAATAAAGAAAAATTTAAAGTATTTGTTAATAGACTATTCTAATGCAGTCTTTTATTCAAACTGCTTATGTTAGGGAGCAAGAAAGATAGTGGTATTCATATCCCTGCCCTCTCAGAGTATCTATTCTGAAATAATTTTAGTGGCTTGCTGCAACAGAATCAACTATATCATGAGTTCCTGAGTGTTGGCAATGAACTCAAACTAATCCAGCTCCTCCCAGTGGTTTAAGATGTTAATACCATTGTAAAGCCACTTCAATCCTATAGTTAATCTTGAGTAAACAGGTATTTTTGCTGCTTTTCTTATATGAAGGAGATGCTACTAATTGACCATCAAAAGAACATGTTTTGAGGTCCTCCCCAAACCCTGATGAACAGTTAGAATACACCAGCTATGATGTTGTACCAGTTCTAGTGTCTTAACAGACAATTTGAAAAGAGATTTAAAAAAAAAATTTAGGTAAGGACAATAAAAATGGAATTCAATTACAAAACGAGTATGAGAGAATGGTATAATTCTTCAGTAGTTTATATTAAACACTTTGGAATGTACTATGAACTTCCTCCATTAGAGCTGCCATCATATAACTGGTTGAGATTAAAGAATCAGTCTATTCGAGCCTCAAAAATGGCCATATAAAGTAGATCTCATTATTGTATTTAACATGAAGAATCTAAGGCTGTGTGACTGGACAGAAAATTGAGTTGTTAGGAACCAAACTCAGATTTTCTGGTTTCAAATCATCAACTCTTTGTTTTACGACGCCAGGTCCTTTGAAGCCTAGACACCTACTGAGTAATGGGGAAATCTCATCGAGATTTGAAATGTATTTGCAACATCCACAATGTGGCTAATCAACATGTGGATAATGCAGAATTGATTGTGTATTGTCTTCATTAACATTTGTAGGAAGTTGTACTCTGTGATGTCAAAATAAATGCAGATGATTTAAGTAGGCTGAATTTATATTAAACTCACCATATTTCCAGCATAAAACAGCTTGTGCTTATTATATACATTTGGAAACTCCTATGATGGGAAATATTTAGAAGAATTTTGCCCTAGACATACACATAAGGAAAGTATGAGAACTTTATTGTCACTTATGTTCTGGAGACTGACTTCTACTGATTTT