Transcript asmbl_50356

Sequence
Transcript Sequence for observation asmbl_50356 of TGE0006234:
CAGGCCGTAGGGCGGTCGGAGGGTTTCCGGTTCCGGTGTAACGTTCGGGCTCCGTCTCAGGGGCTGAAGTTTGTGGGGTGCGGTATTGAATCCTGTTTGAGCTGTCCTCCTTTTCCTGCAGAATGGCACTGTCTAAGAGGGAGCTGGATGAGCTGAAACCATGGATCGAGAAGACAGTGAAGAGGGTGCTGGGTTTCTCAGAGCCCACGGTGGTCACAGCAGCACTGAACTGTGTGGGGAAGGGCATGGACAAGAAGAAGGCAGCTGACCATCTGAAACCTTTTCTTGATGATTCTACTCTCCGATTTGTGGACAAACTGTTTGAGGCTGTGGAGGAAGGCCGAAGCTCTAGGCATTCCAAGTCTAGCAGCGACAGGAGCAGAAAACGAGAGCTAAAGGAAGTGTTTGGTGATGACTCTGAGATCTCGAAGGAATCATCAGGAGTAAAGAAGCGACGGATACCCCGTTTTGAGGAGGTGGAAGAGGAGCCAGAAGTGATCCCAGGGCCTCCCTCAGAGAGCCCTGGCATGCTCACTAAACTCCAGATCAAACAGATGATGGAGGCAGCAACACGACAAATAGAGGAGAGAAAAAAACAACTGAGCTTCATTAGCCCCCCTACACCTCAGCCAAAGACTACTTCTTCCTCCCAACCAGAGCGACTTCCAATTGGCAACACTATTCAGCCTTCCCAGGCAGCCACTTTCATGAATGATGCCATTGAGAAGGCAAGGAAAGCAGCTGAACTACAAGCCCGCATCCAGGCCCAGCTGGCACTGAAGCCAGGGCTCATAGGCAATGCCAACATGGTGGGCCTGGCCAATCTTCATGCCATGGGCATTGCTCCCCCAAAGGTGGAGTTAAAAGATCAAACTAAACCTACACCACTGATTCTCGACGAGCAAGGTCGCACTGTAGATGCAACAGGCAAAGAGATTGAGCTGACACACCGCATGCCCACTCTGAAGGCCAATATTCGTGCTGTGAAGCGGGAACAATTCAAGCAACAGCTGAAAGAAAAGCCATCAGAAGACATGGAGTCCAATACCTTTTTTGACCCCCGAGTCTCAATTGCCCCTTCCCAGCGCCAGAGACGCACTTTTAAATTCCATGACAAGGGCAAATTTGAGAAGATTGCCCAACGATTACGGACAAAGGCTCAACTGGAAAAGCTGCAGGCAGAGATCTCACAGGCAGCTCGAAAAACAGGCATCCATACTTCAACTAGGCTAGCCCTCATTGCTCCTAAGAAGGAATTAAAGGAAGGAGATATCCCTGAAATTGAGTGGTGGGACTCTTATATCATCCCCAATGGCTTTGACCTTACAGAGCAAAATCCCAAGAGAGAAGATTACTTTGGAATCACAAATCTTGTTGAACATCCGGCCCAGCTCAACCCTCCAGTTGACAATGACACACCAGTTACCCTGGGAGTATATCTTACCAAGAAGGAACAGAAGAAGCTTCGAAGGCAGACAAGGAGAGAAGCACAGAAGGAACTCCAAGAGAAAGTCAGGCTGGGCCTGATGCCTCCTCCAGAACCCAAAGTGAGAATTTCTAATTTGATGCGAGTGTTAGGAACAGAAGCTGTTCAAGACCCCACGAAGGTAGAAGCCCATGTCAGAGCTCAGATGGCAAAAAGACAGAAAGCGCATGAAGAGGCCAACGCTGCCCGAAAACTTACAGCAGAACAGAGAAAGGTCAAGAAAATTAAAAAGCTTAAAGAAGACATTTCACAGGGGGTACACATATCTGTATATAGAGTTCGAAATTTGAGCAACCCAGCCAAGAAGTTCAAGATTGAGGCCAATGCTGGGCAGCTGTACCTGACAGGGGTGGTGGTACTGCACAAGGATGTCAACGTGGTAGTAGTGGAAGGGGGCCCCAAGTCCCAGAAGAAATTTAAGCGTCTTATGCTGCATCGGATAAAGTGGGATGAACAGACATCTAACACAAAGGGAGATGATGATGAGGAATCCGATGAGGAAGCTGTGAAGAAAACCAACAAATGTGTACTAGTCTGGGAGGGTACAGCCAAAGACCGGAGCTTTGGGGATATGAAGTTCAAACAGTGCCCTACGGAGAACATGGCTCGGGAGCATTTCAAAAAGCACGGGGCCGAACACTACTGGGACCTTGCGCTGAGCGAATCCGTGTTGGAGTCCACCGACTGAGGCCGCCGCGGGCCCTGGCCTCTGCCCGCTGGCCTGCGTCTCTTCAGTCCTCCCCCTCGTTCTCCTTCCCAGCCCAGCCCCCCGTGTGTGTGATCTGAGAACTGTGCCACGCCGACATCGGGACAGAAGGAGAGCACTGGCTCCCCTCCCGTCAGCCTGGTGCTGCCCTTTCCTCTATGTGCATACGATTAAAGAGTTATTTTTAAAGGTGGTATGATATTTTTCACACACTCATAGGATTGGAG