Transcript asmbl_50242

Sequence
Transcript Sequence for observation asmbl_50242 of TGE0006216:
CGATGCCTGACGCGATGCCGCTGCCCGGGGTCGGGGAGGAGCTGAAGCAGGCCAAGGAGATTGAGGACGCCGAGAAGTACTCCTTCATGGCCACCGTCACCAAGGCGCCCAAGAAGCAAATCCAGTTTGCTGATGACATGCAGGAGTTCTCCAAATTCCCCACCAAGACTGGTCGAAGATCTTTGTCTCGCTCCATCTCTCAGTCCTCCACTGACAGCTACAGTTCGGCTGCGTCCTATACAGATAGCTCTGATGATGAGGTTTCCCCCCGAGAGAAGCAGCAAACCAACTCCAAGGGCAGCAGCAATTTCTGCGTGAAGAACATCAAGCAGGCAGAATTTGGACGCCGGGAGATTGAGATTGCAGAGCAAGACATGTCTGCTCTGATTTCACTCAGGAAACGTGCTCAGGGGGAGAAGCCCTTGGCTGGTGCTAAAATAGTGGGCTGTACACACATCACAGCCCAGACAGCGGTGTTGATCGAGACTCTCTGCGCCCTGGGGGCTCAGTGCCGCTGGTCTGCATGCAACATCTACTCCACTCAGAATGAAGTGGCTGCAGCACTGGCCGAAGCTGGAGTCGCAGTGTTCGCGTGGAAGGGCGAGTCGGAAGATGACTTCTGGTGGTGCATTGACCGCTGTGTGAACATGGATGGGTGGCAAGCCAACATGATCCTGGATGATGGGGGAGACTTAACCCACTGGGTTTATAAGAAGTATCCAAACGTGTTTAAGAAGATCCGAGGCATTGTGGAAGAGAGCGTGACTGGTGTTCACAGGCTGTATCAGCTCTCCAAAGCTGGGAAGCTCTGTGTTCCAGCCATGAACGTCAATGATTCTGTTACCAAACAGAAGTTTGACAACTTGTACTGCTGCCGAGAATCCATCTTGGATGGCCTGAAGAGGACCACAGATGTGATGTTTGGTGGGAAACAAGTGGTGGTGTGTGGCTATGGTGAGGTGGGAAAGGGCTGCTGTGCTGCTCTCAAGGCCCTCGGAGCAATCGTCTACATCACAGAAATCGACCCCATCTGCGCCCTGCAGGCCTGCATGGATGGGTTCAGGGTGGTGAAGCTAAATGAAGTCATCCGGCAAGTCGATGTTGTGATAACTTGCACAGGGAATAAGAATGTAGTGACACGGGAGCATCTGGACCGCATGAAAAACAGTTGTATCGTATGCAATATGGGCCACTCCAATACGGAAATCGATGTGACCAGCCTCCGCACTCCGGAGCTGACGTGGGAACGAGTCCGTTCGCAGGTGGACCATGTCATCTGGCCAGATGGCAAGCGCGTCGTCCTCCTAGCAGAGGGTCGTCTGCTCAATCTGAGCTGCTCCACAGTTCCCACCTTTGTTCTGTCCATCACAGCAACCACACAGGCTTTGGCACTGATAGAACTCTATAATGCACCAGAGGGACGATACAAACAAGACGTATATTTGCTTCCTAAGAAAATGGATGAGTACGTTGCCAGCTTGCACCTGCCATCATTTGATGCCCACCTGACAGAGCTGACAGATGACCAAGCAAAATATCTGGGACTCAACAAAAATGGGCCGTTCAAACCCAATTATTACAGATACTAATGGACCACATTGCCAGGGACCAGTCCACATGAACCACACAACTCTAAAAGAAATATTTTTTAAGATAACTTTTATTTTCTTCTTATTCTTTTCCTCTTGATTTTTTTTTCTATAATTTCATTCTTGTTTTTTCATCTCATTATCTAAGTTCTGCAGACCACACAGGAACTTGCCTCATGGCTCTTTAGATGAAACAGATTCAAGGTTTCTCACCCTAGTCACTAAAGAAGGATTCTCTTCCAGCCCAGAAAGGTGATTCTTTCTTTACCATTTCTGGGGACTTTAGTCTTAAGTGGGTACCTTATTAACAGGAAATGCTAAGGTACCTTCTATGTGGAACAATCTGCAATGTCTAAATTGCCTTAAAAGAGCCCATTTCCTAGCTGCTGAAATCAGTGCTCTTTGATTTCTTCAGAGGAGCAGGGATAGTACCTACCAGCCAGGTAGGTTAGATGTAGGTGGTGCATGTTAATTCCCCCTCGATGTTCCAAGCCCTGTTTCCTGTGTGAAGATGGTTTGTCTGGTTCAGAGATGTGTACTAGTGAGTGTTGCTTGTTAAGATCCGGTAGGGTTTAGTACAGTTCTTCTTCCACTCCACCCAGACCTTCTCTTTTTTCAGGTTTTTAACCAGATTGCACTCTATTAAGTTGAATTTGGCTCCTAGCATTTATATCTGTTA