Transcript asmbl_49967

Sequence
Transcript Sequence for observation asmbl_49967 of TGE0006193:
GCCGGCGCTACATACTGCGCCTGCGCACGAGCTGGGGCCTTTTTTCCCCCCGGAGCTGTGCTTGGCCTGTAGGTCTGTGACGAGCCGCGAACGCGGGTCTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGTTGTCAAGAATAAGGCCTACTTCAAGAGATACCAAGTGAAATTCAGAAGACGACGAGAGGGTAAAACTGATTACTATGCCCGAAAACGTTTGGTAATCCAGGATAAAAATAAGTACAACACACCCAAATACAGGATGATAGTTCGTGTAACCAACAGAGATATCATTTGTCAGATTGCTTATGCCCGTATAGAAGGAGATATGATAGTTTGTGCAGCTTATGCTCATGAACTTCCAAAGTACGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATATTGTACTGGCCTGCTGCTGGCCCGCAGGCTTCTCAATAGATTTGGCATGGACAAAATCTATGAAGGCCAAGTGGAGGTGACCGGAGATGAATACAATGTGGAAAGCATTGATGGTCAACCTGGTGCCTTTACCTGCTATTTGGATGCAGGGCTTGCAAGAACTACTACTGGAAATAAAGTTTTTGGGGCCCTGAAGGGAGCTGTGGATGGAGGCTTGTCTATTCCTCACAGTACCAAACGATTCCCTGGCTATGATTCAGAAAGCAAGGAATTCAATGCAGAAGTACATCGGAAGCACATCATGGGTCAGAACGTTGCAGATTACATGCGTTACCTAATGGAAGAAGATGAAGACGCTTATAAGAAACAGTTCTCTCAATACATAAAGAACAACGTAACTCCAGACATGATGGAGGAGATGTATAAGAAAGCTCATGCTGCTATACGAGAGAATCCAGTCTATGAGAAGAAGCCTAAGAAGGAAGTTAAAAAGAAGAGGTGGAACCGTCCCAAAATGTCTCTTGCCCAGAAGAAAGATCGGGTAGCTCAGAAGAAGGCAAGCTTCCTCAGAGCTCAGGAACGGGCTGCTGAGAGCTAATAAACCAAACTGAAATTTTCTATTAAGATTTTTCATATAAAGATAGTAATAAACTTATTGAATCTGCA