Transcript asmbl_49910

Sequence
Transcript Sequence for observation asmbl_49910 of TGE0006181:
TTTTCGTCTTTAGACATGGGCACACCACAGAAGGATGTTATCATCAAGTCAGATGCACCCGACACCCTATTATTGGAGAAGCATGCAGATTATATCGCATCCTATGGCTCAAAGAAAGATGATTATGTATGTATGGTTTTATGTTAAAAGCTTATTTTAAAGAAGTCAGACCATTCGGCATCATCGGTAGGAATACTGTATGTCTGAGTATTTGAGAATGAGTGGCATCTATTGGGGTCTGACTGTAATGGATCTTATGGGACAACTGCATCGCATGAATAGAGAAGAAATTCTCACATTTATTAAGTCATGTCAACATGAGTGTGGTGGAATAAGTGCTAGTATTGGACATGATCCTCATCTTCTGTACACTCTGAGTGCTGTCCAGATTCTTACTCTGTATGATAGTATTAATGTTATCGACGTAAATAAAGTTGTAGAATATGTTCAGAGTCTACAGAAAGAAGATGGTTCTTTTGCTGGAGATATTTGGGGAGAAATTGATACAAGATTCTCTTTTTGTGCGGTGGCAACTTTGGCTCTATTGGGAAAGCTGGATGCTATTAATGTGGAAAAGGCAATTGAATTTGTTTTATCATGTATGAACTTTGATGGTGGATTTGGTTGTAGGCCAGGTTCTGAATCTCATGCTGGGCAGATCTATTGTTGCACAGGATTCCTGGCTATTACTAATCAGTTGCATCAAGTAAATTCTGATCTACTTGGTTGGTGGCTTTGTGAACGACAGTTACCTTCAGGTGGACTCAATGGAAGGCCAGAGAAGTTACCAGATGTCTGCTATTCATGGTGGGTGTTGGCTTCCCTAAAGATAATTGGAAGGCTTCATTGGATTGATAGAGAGAAACTACGTAATTTCATCTTAGCGTGTCAAGATGAAGAAACAGGAGGATTTGCAGACAGGCCAGGAGATATGGTTGATCCTTTTCATACTTTATTTGGAATTGCTGGATTGTCACTTTTGGGAGAAGAACAGATTAAACCCGTTAGTCCTGTTTTTTGCATGCCTGAGGAAGTACTTCGGAGAGTGAATGTTCAGCCTGAACTAGTGAGCTAGGTTCACTGATGCATAAGTTGCTCAATATAGTTTTGCCATCTTAACATTTCTGTATTTGAAGTGCTTACCAAACAATATGTTAATATTTTGTATATGTATTGATTTTTAATAAATTGTATAATTATACATATTGTAAAATAAAGGCCTAGTGTGTCTTCAGCTTTTCTGAGTACAATATTTGGTTTATACTTTAATGTATTTATATTCTTTGTAGCAGTAATCTTTAAGAACTATTTAGTTGAAGTCAAGTGTTATACTTGATTTTATCCTGTGCTTCCTTCATATTTTTATGTATGATAGTTCATGTAAATTGGTCTGTGTCAGTGATAATGTTAACTGATAAAAAAAATTGATAAGCCTCATTCTAAATATGAATTAAAAGATTTACAAAAACAAATGGCTGTTGAAATTTGGGAGTATTTCATAGGTTTATGGTTAACTCTGAGTTGGTCACAGTGATTTAGGTAAATGACAGTTCGTCTTAGAATATGATTACAATCGGGACTACACTTTATTCTCATTTTTAACATGTCAAAATGCCAGCTTCTTAAGCGATGGTTGGTCTTTTCCCCTTAATAAGGAGACAAGTAATAGTTGCCACAATATTTTGTGTACCCGTGTTTTCAGAAAGACTAAAATGAGCACAACTATTCTCTAAAAGTTTTTACATTCTTGGTGAAATAAAGTATTTTAATGAACATTTTTTGCGAGGTGAAAGTTGAAATTTTTCTCAAGTGTGTTTGCAATAACCTGTGTCATTTTAAGAGTAGTGTTACACAAGTAATGGTTCACTCAACATTGTTGACCAATAATACATGGTTAAACACCTTGAACGTAGGTGCTTGCATGAAATTCACTAGAGTTTTGACTAAATTGCAGTTTATGAGTTTGGAAGTCTTTGGATGAAACTTAAAATGGTGTCAGAAGTATTTGAAGTTTTGCAAAATGCAGTCATTGCTTGTGGGTGAACTATGTTGTTAAATACCTGCTTTAT