Transcript asmbl_47871

Sequence
Transcript Sequence for observation asmbl_47871 of TGE0006098:
CGTGGGCGCTGGAGAAGGGCGTGCTCGGGCGAGCAGCACTCGCGGCGCCGCAGGACATGAATGCAGTCCAAGTCCTGGGGGTGCCCGGGGGGCATCGTAGCGAAATTGCCTTGCTGGTCCATTGGGAGCGCGTCCAGAACCCCAGGCTTAGCTCTCTTTGCAACACCCAGCCAGGTCCCCACCGGGCACCTGGCCGCGCTCGGCTGTCCGGTCGCGGGCATGCTGCCTTGAGCCGCTGACCCCGCTGGAGACCCTGCATGCCAGCCTGGCCTGAAAACGGAGGACTCCACAGACCCGGTCCTCCCCACACCTCTTCTGCACAGAAGCAAACCCTCCTGACTTAGCCACGGCTTCCAGAACCTCTGAGACGGGAGGCCCCCAGGTTTACCTCATGTTTGGGGCATCTTGCTAGCTATGGCCCTGATCCTAGGCTTCTTGCTGCTGCTGGGGCTGGGCGGGAATACCATTTCAGAGGAGCCGCTGTCATCCAAAAGGACTACTTCTGATGTTCTGGAGTTTAAACTCCGGGAAGTGAAGTATGAGACCGAAGACTCTTATAAACTTGGACCCATTGGCATTCTCTTTCAAGTAGTGCACGTCTTTCTCCACGTGGTGCAGCCCAATGCTTTCCCCGAGGATATTCTCAAGAATGTATTACGAAACAAGTTTGACCTCTCAGCTGATTATAAGAAGATCATCCAGTATGAGCTGGGGATCATTATCTGCGCCGTCCTTGGCCTGCTCTTCATTATTCTGATGCCTCTGGTGGGGTTTTGCTTTGGTTTGTGTCGTTCCTGTAACAAGTGCGGTGGAGAAATGCACCAGCGACAGAAGAGAAACGGGACCTGTCTGAGGAAATACTTTGCAGTCTCTCTCTTGGTGATTTGTATGTTTATAAGCGTTGGTATCATCTATGGTTTTCTGGCAAACCACTACCTGAGGACCCATATCGAAAAGACTCAAAAACTGGTAGACAGCAACTTCAGAGACTTGAGAACTCTCCTGGACGAAACTCCAATGCAAATCGACTATGTACTGGACCAGTATAACACCACTAAGGAAAAGGCATTTTCAGATCTGGACAATGTTAAATCATTGCTGGGAGGCAGAATTCGCGATCAGCTAAGACCTAAAGTGATCCCTGTTCTTGATAACATCAAGGCCATGGTTGAAGTAATCAAAGAGACCAGAGAAGCCCTGTCGAACACGAACAATGCCTTAAAGGACCTGAAAAAATCAATTGCACAACTTGACACCAGCCTGAGTGACGTTAAAACGGACCTGGAGCAGGCACTCAGTGACCCCCTGTGCTCTATACCTCCAATAACCACCACTTGCAACGAGATCTCAATGACTCTAAACCAGCTGGATAACAACACTGACGTGGGAAAGATTCCCTTGTTGGATAATCAACTTGATAATGTTAATCATGTTCTTCAAACAGATTTGTCTAGCCTGGTCCAGAAGGGCTATCAAGCCTTTGATGACATACCTGAGATGGTGCAAAACCAAACCACGAACATAGTATTAGATATCAAAAGTACCTTGAATTCCATTGGTTTAGATATCAAACAAAAAAATGAACAGATTTCTATTCAGAATAAGCTGTCACGTTTCATGGATCCCATTAATTACGTTGAAAGTTATATCTACAACAAATTACGCAAGTTGAAAGAATATGACTCATACAGGTGGCTGAGCAGCTTGGTTATCTGCTGTTTCCTGACACTCGTCACGACTTTTTATTCCTTGGGCATATTATGTGGCATTTTTGGCTATGACCCGAATGCCTCCCCAACGAGAAGAGGTTGCATCTCCAACACCGGGGGCATCTTCCTCATGACTGGGGTTGGAATCAGTTTCCTCTTTTGTTGGCTATTGATGATCATTGTGGTTCTTACTTTTGTTATTGGCGGAAATGTGGAAAAATTGGTCTGCGAACCTTACCAGAACAGGAAGTTATTCCAGGTTTTGGACACACCGTATTTACTAAATGAGAATTGGAAATACTACCTCTCAGGCATAATATTTAACAAACCGGATATCAATCTTACTTTTGGACAAATATACAGCGATTGCAAAGAAAATAAAGGCATATATGCCACACTGAAGCTGGAAAACCGCTACAATATCAGTGAATATCTCAACGTTCAGGAGTACACCGAGAACATAAACAGTTATTTTGACAATCTCAACATAAAGATTGATAACATCGTTCTGCTGGACGACGCGGGAAGAAGAAGTCTCATGGATTTCGTTTCTTCAGGCGTAGATAGAATAAATTATGACGCTTACTTGGCTGAGACAACTAAAGCACCCACAAAAGTGAATCTTTTATTATTTGCAGATGTCCTACAAGAGAAAGCCAACCAATTGCCCCCAGGAAACTTGAGATCGTCCCTGATAAGAAACGAACAGATGATTAGAAGGATTTACCATGACCAAGTCATACCTCTGGAACTATCGATGAAAGGTATATACCGAAGCATCCAGGAGCTTCAATACAAAAGCAGTGGATTGGGGGCGAGTGTGAGCGATATCATTTCCTCTTTGGATTCAGCTCAGAAATTCATCGTCAAGAATATTTCCTCTATTATCATTAAGGCAAGTAAGAAGTATGGGAATACGATACTTGGATATTTTAAACTTTATCTGCAGTGGGTCAAGGTCTCAATCACTGAGCAAATCGCGGCCTGCAAACCTGTGGCCACCGCATTAGATTCTGCTGTGGACGTCTTTCTGTGCAACTACATTGTCGAACCCATGAATCTGTTTTGGTTCGGCATAGGAAAAGCGACCATATTTTTACTTCCAGCAATCATTTTTGCTGTAAAGCTGGCCAAGTACTATCGTCGAATGGATTCAGAAGATGTGTATGATGATGTTGAAACTGTCCCCATGAAAAAGTAAGCCTTTTCTTTTTTAAACCGTATTCATAAGCTCAGATGGGGGGGAGGCTCTTTATTATTATATGATGGACTTTTTAAATTAAGAACATCTTAAAATGAGGTAACGACAGTAGGCGTGCCCAGATTAAAATAAATGCTGATGTCTGTTGAAATAAGGACTGGTAAATAAGGACTGGGCGTTGAAGAAGTATTTGTCGAATTAATGAAAATTTTGTGTGTTAAATTTATGAATATACAAAAGGGTTGTTTTGAGATTTGATCTTTAAAGGGAGCAACATGTAAATATGCCCTTTGGCCTTTTTTTGTGTATTTGACAAGGCGTCAGATATTTTTCATGACTCTTACATTGTCTTTGTCATCCACGATATCGATACTTTGTCTTAGTAATAACATGGTGTTTGTGATGTATTTGTTTTTGTCACAGTATGCAAAAGGGTAATGTTGATTTTAATAGCCATCAAACCGCTCAG