Transcript asmbl_46989

Sequence
Transcript Sequence for observation asmbl_46989 of TGE0006025:
GGCGGCTTCCGCTACGCCCTGACAACAGCGGGGTCTCTGACTACGCTGGGGTGGGCTACCGTGGGCCTCCGGGCGGCGGTCAACGATGCTGAAGGCCAAGATCCTCTTCGTGGGGCCCTGCGAGAGTGGAAAAACCGTTTTGGCCAACTTCCTGACAGAATCTTCTGACATCACCGAATACAACCCAACCCAAGGAGTGAGGATCCTGGAGTTTGAGAACCCACATGTTACCAGCAACAACAAAGGCACCGGGTGTGAATTTGAACTATGGGATTGTGGCGGTGATCCAAAATTTGAGTCTTGCTGGCCAGCCTTGATGAAGGACTCTCACGGAGTGGTGATCATCTTCAATGCTGACATCCCAAGCCACTTGAAGGAAATCGAGATGTGGTATTCCTGCTTTGTCCAGCAGCAGTTCCTGCAGGATACTCAGTGTCTGTTAATTGCACACCACAAACCAGGCTCTGGAAGTGGTAAAGGAAACCTATCTTTGTCGCCACCCTTGAACAAGCTGAAGCTGGTACACTCAAATCTTGAGGATGACCCTGAAGAGATCCGGATGGAATTCATAAAGTATTTAAAAAGCATAATCAACTCAGTGTCTGAGAGCAGAGACCGGGAGGAGATGTCCATTATTACCTAACCAGCCTTCATCTGGACTCTTCTGCATCCCAAGTGAGGTCAACTTCTTTCCCAGTGCAGATCTGAAATCTTACCCAGTTACTGATGTTTTCTTCTCCCAATGGCCCTTGAAAAAATTTTCCTTCCCTGCTTGCAGGTACCAGTTGCCCAGGGAGTTGAATCATACAATCTAAGCCCTGTCCTTAGTTCAGGTGAGAAAATCCTGTTACTGAATTTTGATTTCTTTGCCCCAGGTTGCTTCAAAGAGCTGGAAAACTGAGGTGTTTTGTTTTCCCCTTCACATATGTCAAGTTATAAAACTTGTGGAATTGTAACTGTCATAGCCTAATCCATGCGTATTGGTTTGAATGTGATTTTCATTTCTTAATTCACTCAACAAATAGCGACTTGTTGAGCATCTACTATTGGCTACACTGTTCTAGTTGCAGACAGTATACAGCATGAACAAAATAAAAACCCTTGCTCTCATGGAACTTCTATTATAAAAAAATAGTGAGGTAGTCAAAAACTGAATTACTATACCTTGGATATGCAAAAAAAAAATATTATGGATTCTTCTTTTCTGTAATTGGTCTAACTCTAATGCACCTACCCTCCTAGATAATTAACAGACTTGGAGTATGTAACATGCAAAGGAAGGTACAGTCAGTCCTCATTCATGGATTTTGTATTTGCGAATTTGCCTACTTGCTAAAATTTATTTGTAACCCCCAAATCAATACTCACAATGCTTTGACAGTTATTCAGAGTGGCAAAAAATTTGAATCACTGGATACGCACATTCCCAACTGAGGCCGAAACAAGAAGGCAGCGCTCTGCCTTCTTGTTTCAGCTGTTGTATTGTAAACCAGTGTCCTTGTTGTGGTATATTTAGTACCACTTTTTCATATTTTTGTGCTTCTCATTGGTTATTATTTTGTTGGTTATTAAAATGCCCCTCCCCCCAAACGTAGTGCTGAAGTGCTGTCTGGTGGTTCCTAAGCACAAAAAGGCTGTGATGTGCCTTATGATGAAAATAGATATGTTAGATAAGCCTCATTCCAGCATGAATTATAGTGCTGTTAGTTGTGAGTGCAGTGTTAATCAACAACATATATTAAATAAAGTATCTTTAAACAGAAGCATACAGAAAATAAAGTTATGTATTAATAGTTGAAAATATTGTGATCAGAGGCACGCAGGAACCTAACCCTGTATTTCCCTGGGAGAAATGCTTTGGTGTTCATTAATCCATTGTTTGTGGTAACATTACAGAACATAATGACCATGAATAATGAGAATCCACTGTATTTCCATCTCTTGCAATTTAAATGTTTTCAGGTTAGTTCAGCCTCTAATAAATATTTAATTAATTCAAAATTACAATCCACTTCCTCTACATTCTCCCCAACATGATATCATGGTGTCGGGACAGTGTTTGTGTCCCTCATTGTGGTGGGGCAGCTGTTCCAAAGGAAGGTCCTCTGGCTCCCTACTTGACCTCTGTCAAGATGTCCACTGGCCACCCTATTGGCCATCTCCCACCAAGTGTAAGACTGGTGAGTCTCATGTGCTCTCCCCATGAAACTAGTGATCCCTAGGCTGACTTGGCCCCATCCTGGCTGGGGCTGGCCCTGCACATCTCTGAGAGCCATCTGTGTCTCTCATCCATCTCAAGTTTCTTTGTAGCTGTATGGCAGGATCACTTTACCCTTTGCCACAGCTGGCCTGTCCAATTCATTCTCTATGTTCTGCTTACTGGGAGAAAAGCATGATTTGGGGAGGAATTGAGAACATGGCAGATGAATATTTTCAAAATATTATCCTCATTACAACAGTAAGCAATGCAGTTATGTTTTCATTATAAACTGACAGGAGGGTTTACCTGATCATGCAGAATATTTTTTAAATTTTAACAATACTGTTGTCCTTTTTAATTGTGAAATATAAATAACATAAAGTTTACCATTTTAGCCATTTTAA