Transcript asmbl_46968

Sequence
Transcript Sequence for observation asmbl_46968 of TGE0006023:
CAAGAACCCCTGTGCAGTGTGGAGGTCGTAGGAGTCACTTACTCACCGCCAGGTCCTTCGCTTGCTGGTCCGCGCCCCGCCCGCCGCAGCCATGCTCTCAGCCCTTGCCCGGCCTTCCGGCGCCGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAGGTAGCCGTGCTCGGGGCTTCTGGAGGAATTGGGCAGCCCCTTTCACTTCTCCTGAAGAACAGTCCTTTGGTGAGCCGCCTGACCCTCTACGATATTGCTCATACGCCTGGAGTGGCGGCGGATCTGAGCCACATCGAGACCAGAGCAAATGTGAAAGGCTACCTCGGACCTGAGCAGCTGCCCGAATGCCTGAAAGGTTGTGATTTGGTGGTTATTCCAGCCGGAGTCCCAAGAAAACCAGGCATGACACGGGATGACCTGTTCAACACCAATGCCACAATTGTGGCCACCTTGACTGCTGCGTGTGCTCAACATTGCCCTGACGCCATGATCTGTGTCATTGCAAATCCGGTCAACTCCACCATCCCAATCACGTCAGAAGTTTTCAAGAAACATGGAGTATACAACCCCAGTAAAATCTTTGGGGTGACGACCCTGGATATTGTCAGAGCCAACACTTTTGTTGCAGAACTGAAGGGTTTGGATCCAGCTCGAGTCAATGTCCCTGTCATTGGCGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCAGTGCACTCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCGCTTACTGGGCGGATCCAGGAGGCTGGCACGGAGGTGGTCAAGGCTAAAGCTGGAGCAGGCTCTGCCACCCTGTCCATGGCATATGCCGGAGCCCGGTTTGTCTTTTCCCTTGTGGATGCAATCAACGGAAAGGAAGGAGTGGTTGAATGTTCTTTTGTTAAATCCCAAGAAACGGACTGTCCCTATTTCTCCACACCATTGCTGCTTGGAAAAAAGGGCATCGAGAAAAATCTAGGCATTGGCAAAGTTTCCCCTTTTGAAGAGAAGATGATAGCTGATGCCATTCCTGAGCTGAAAGCCTCAATCAAGAAAGGAGAAGAGTTTGTGAAGAACATGAAATGAGAAAACTGTTAGCAGGCAGTCCATTTCCTTAACTTATTAAGGCATTCTGTCACTGTAAAGCATTTCAGATTTCTTTGTATTTCATTTTGCTTTAACGATGAATATTGTATTAATGTTACCATCCCTTCCTAGTTGCGGATCAGTCTATTGGTGCATCAATAAAAGTAGGCTTTGATTTTCTTTTTCAAGGTCTCTGCCATAAATATTGTGCTTTCTTCCCTACTAGAGCTGACTTGAG