Transcript asmbl_46812

Sequence
Transcript Sequence for observation asmbl_46812 of TGE0022240:
AAGCAGGCCCTTCTGAAACTGATGATGTTGATGACAAACTCCCCCTTTCGAAGTCTTTGCAAGGAAGCCATCATTCTTCAGAGGGCAATGATGGAACAGAAATGGAAGTACCAGCAGAAGATGATGATTATTCTCCACCTACTAAGAGACCAAAGAGCAATGAGCCACCCCAGCCACCAGTCACAGAACCCGCCAATGCCGGAAAACGGAAAGTGAGAGAGTTCAACTTTGAGAAATGGAATGCTCGAATTACTGATCTGCGTAAACAAGTCGAAGAGTTGTTTGAAAGAAAATATGCTCAAGCTATAAAAGCCAAAGGTCCTGTGACGATCCCATACCCTCTTTTCCAGTCACATGTTGAAGATCTATATGTGGAAGGACTTCCAGAAGGAATTCCTTTTAGAAGGCCATCTACTTATGGAATTCCTCGCCTTGAGAGAATATTACTTGCAAAGGAAAGGATTCGTTTTGTGATTAAGAAACACGAACTTCTGAATTCAACACGCGAAGACCTACAACTTGATAAACCAGCTTCAGGAGTAAAGGAAGAGTGGTATGCCAGAATCACTAAATTACGAAAGATGGTAGATCAGCTTTTCTGCAAAAAATTTGCTGAAGCCTTGGGGAGTACTGAAGCCAAGGCTGTACCTTACCAGAAGTTCGAGGCACATCCTAATGATCTCTATGTGGAAGGACTTCCAGAAAATATTCCTTTTAGAAGTCCCTCGTGGTATGGAATCCCAAGGCTTGAAAAAATCATTCAAGTGGGCAATCGAATTAAATTTGTTATTAAAAGACCAGAACTTCTGACTCACAGTACTACTGAAGTTACTCAGCCAAGAACGAATACACCAGTCAAAGAAGATTGGAATGTCAGAATTACTAAACTACGAAAGCAAGTGGAAGAGATTTTTAATTTGAAATTTGCTCAAGCTCTTGGACTCACAGAGGCAGTAAAAGTACCATATCCTGTGTTTGAATCAAATCCTGAGTTCCTTTACGTAGAAGGCTTGCCAGAAGGAATTCCCTTTCGAAGTCCTACCTGGTTTGGAATTCCACGACTTGAAAGGATTGTCCGTGGCAGTAATAAAATCAAGTTTGTTGTCAAAAAACCTGAACTAGTTATTTCCTACTTGCCTCCTGGAATGGCTAGTAAAATAAACACTAAAGCCTTGCAGTCCCCGAAAAGACCACGAAGCCCTGGGAGTAATTCAAAAGTTCCTGAAATTGAGGTCACTGTGGAAGGCCCTAATAACAACAACCCTCAGACCTCAGCTGTGCGAACCCCTACCCAGACTAATGGTTCTAATGTTCCTTTTAAGCCTCGAGGGAGAGAGTTTTCCTTTGAGGCATGGAATGCCAAAATCACAGACCTAAAACAAAAAGTTGAAAATCTTTTCAATGAAAAATGTGGTGAAGCTCTCGGCCTTAAACAAGCTGTGAAAGTGCCATTTGCATTATTTGAGTCTTTCCCAGAAGACTTTTATGTAGAAGGCTTACCGGAGGGTGTGCCATTTCGTCGACCATCTACTTTTGGCATTCCAAGGCTGGAGAAGATACTCAGAAACAAAGCCAAAATTAAGTTCATTATTAAAAAGCCCGAAATGTTTGAGACAGCAATTAAGGAGAGCACCTCCTCCTCTAAGAGCCCTCCAAGAAAAATAAATTCGTCGCCCAATGTTAATACTACTGCATCAGGTGTTGAAGATCTTAACATCATTCAGGTGACAATTCCAGACGATGATAATGAAAGACTGTCTAAAGTTGAAAAAGCTAGACAGCTAAGAGAACAAGTTAATGACCTCTTCAGTCGAAAATTCGGTGAAGCTATTGGTATGGGTTTCCCTGTGAAAGTTCCCTACAGGAAAATCACAATTAACCCTGGCTGTGTGGTAGTTGATGGCATGCCTCCTGGAGTGTCATTCAAAGCTCCCAGCTACCTGGAAATCAGTTCCATGAGAAGGATTTTAGATTCTGCTGAGTTCATTAAGTTCACAGTCATTAGACCATTTCCAGGACTTGTGATTAATAACCAGTTGGTTGATCAGAATGAGTCAGAAAGCCCAGTGATCCAAGAATCAGCTGAACCAAGCCAGTTGGAGGTTCCTGCAACAGAAGAAATAAAGGAGTCTGATGGAAGCTCTCAGATCAAGCAAGAACCAGACCCTACGTGGTAGACCTCTTCCCTCCTAGGCTTAAAGTATCAGTGGGTGAGAAGAGCTTTTCGGACCTGTTACTGCCCCAAGCTGTGTAATATACTTGTATAACAGAAATACCTTCTATACAAACCTTTTTTTCTACTTTTAGATAGAAATGTCTACTTTTTCAGCAGTTCTGTGAATTGAATTAAAGAGCAGAGTGACTGTAGATTTGGAATGGCTGGTTTACTTTGGAATGTATTATAAGGATTTTACAGCAATGCTGGAAAAACGACAGGGAAAATGACAGGGATGAATCTCACCAGATTTTTTTTATGGATTCAGCAGAGCCTTCAGCTATGGTGTTTATTTTCCAATCAAGTGAAGATATCTCTTACTGGAACATCTCAGCTTCTGCAGTGAAGAAAACACCTGTGATAGTTTAGTTCTTTAGTTTTTCTATTTGAAAAATCATTTAAATGATCCTTTTGTTCACGGCTCTCCTTAATGACTGAGTGAACAGTTAGTATCTGTATATTTGACTAAACCTTTTCCTAAGCTATCTATCATGGTTCATACGTTTTTTATCATAATTAAAAAACAACCATCTGGATTATCTAATAGCCGGTAAGAGGTCAGTATCTCAGTGTGTGGCTTATAGATGGAATACAGAGAACCTCTTCCACATTTACTTTTCATCCAAATAAAATGCATGGTGTACCAGAAGTTTAAGATCAGGTATGACTGTTTGGGCAAGCTAAATGACACTAAAGCCTCACTATCATGTAACCTGTTGTGGTGTGGATTTCTTTGGAACACTGTTCCAGCTTGAATCAATCTCAAGGGGTTTTCATTGCCGTCATTATTTTATAATTCTACTTGTAAAATTGAGGCTCCAGTGTGGGGAATGAAGGGTCATAAGCTAATTATGCACCCACTGATATTCTGCGCCATTTGTAGGAGAATCTTACACATGTTGAGATTTCACAGACAATAAGAGTTGTAAAATCCAAGCTATATGAAAAGCTAGAGTATGTGATGGCATAGAGTGTTCATTAGCTTTATCACAATATTCACAATGGAGAATTATATTACATGGTAGCAGGGATAGGCATTTTTATGTGTTGCTTATATTTTACCTCAAATTAAAATGTAGATATAGGGTAATAAATAAAATCCATC