Transcript asmbl_45870

Sequence
Transcript Sequence for observation asmbl_45870 of TGE0009868:
TTCCTGACAGCACCTCCGCCTTCCCTGCATCTTAGGAAGGCCCAAACAAGACGGGCACCTCCTGCGCCCTGGACTGCGGCGCCGGCATCGGAAGGATCACCAAGCGGCTGCTCCTGCCGCTCTTCGGGGCGGTGGACATGGTGGACGTGACGGAGGACTTCCTGGTGAAAGCGAAGACCTACCTGGGTGAGGAGGGCAAGAGGGTGAGGAACTACTTCTGCTGTGGCCTCCAGGACTTCAGCCCAGAGCCTAACTCGTACGACGTCATCTGGATCCAGTGGGTGATCGGCCACCTGACCGACCAGCACCTGGCCGAGTTCCTGCGGCGCTGCAAGCGGGGCCTTCGCCCCAACGGCGTCATCGTCATCAAGGACAACATGGCTCAAGAGGGTGTGATCCTGGACGACGTGGACAGCAGCGTGTGCCGGGACCTCGGGGTGGTCCACAGCATCATCCGCAGCGCGGGCCTCAGCCTCCTGGCCCAGGAGCGGCAGGAGAACCTCCCCGACGAGATCTACCATGTCTACAGCTTAGCCCTGAGATGAGCGGGGCCTGGCAGGACGAGAGAGACAGGTGCAGGGGTGGGGGGAGCTGGCAGCTGGGTGCCACACAGAGGCTCCACGTCGATGGGTCGCGAGTGTCGAGCGAGGCCACTAAATACATCTGCCTGCCGTCCACTCACTACACAGGCTCTTCTTAAAAATGACAGGACCCAGAGGG