Transcript asmbl_45835

Sequence
Transcript Sequence for observation asmbl_45835 of TGE0022187:
AACTGCCGTCCTTGCCCTCTCTTGTCCCCCTCTCGAATGCTGTCAGATACCATTCTTTGCTGGAACTGGGTGAGAAGCGGAAAGGCATGTTGGAGAAGAGTTGTAAGAAGTTTATGTTGTTCCGTGAAGCGAACGAGCTCCAGCAGTGGATCAACGAGAAGGAAGCGGCTCTGACGAGTGAAGAGGTCGGCGCGGACTTGGAGCAGGTCGAAGTGCTGCAGAAGAAGTTCGACGACTTCCAGAAGGATCTGAAGGCCAATGAGTCACGGCTGAAAGACATCAACAAGGTGGCTGAAGACCTGGAGTCTGAAGGTCTCATGGCAGAGGAGGTGCAGGCAGTCCAGCAGCAGGAGGTGTATGGCATGATGCCAAGGGATGACACCGATTCCAAGACAGCCTCCCCCTGGAAGTCTGCTCGCCTGATGGTTCACACCGTGGCCACCTTTAATTCCATCAAGGAGCTGAATGAGCGTTGGCGGTCCCTGCAGCAGCTGGCCGAGGAGCGGAGCCAGCTCCTGGGCAGCGCCCATGAGGTGCAGAGGTTCCACAGAGATGCTGATGAAACCAAAGAGTGGATCGAAGAGAAGAATCAGGCTCTAAACACAGACAATTACGGTCACGACCTGGCCAGTGTCCAAGCCCTGCAGCGCAAACACGAGGGTTTTGAGAGAGACCTCGCGGCTCTCGGCGACAAGGTAAATTCCCTCGGGGAAACAGCTGAGCGCCTGATCCAGTCTCACCCCGAGTCGGCGGAGGACCTCCAAGAGAAGTGCACGGAGTTAAACCAGGCGTGGAGCAGCCTGGGGAAGCGTGCAGACCAGCGCAAAGCCAAGCTGGGCGACTCGCACGACCTGCAGCGCTTCCTCAGCGACTTCCGGGACCTCATGTCTTGGATCAACGGAATACGTGGGTTGGTGTCCTCAGACGAGCTGGCCAGGGATGTCACTGGAGCCGAAGCTTTGCTGGAACGACACCAGGAACACCGGACAGAAATTGATGCCAGGGCTGGCACTTTCCAGGCATTTGAGCAGTTTGGGCAGCAGCTGTTGGCTCATGGGCACTATGCCAGCCCAGAGATCAAGGAGAAACTAGACATTCTGGATCAGGAGCGTACAGACTTGGAGAAGGCCTGGGTGCAGCGCAGGATGATGCTGGATCAGTGCCTTGAACTGCAGCTGTTTCATCGGGACTGCGAGCAGGCGGAGAACTGGATGGCTGCCCGGGAGGCCTTCCTGAATACCGAAGACAAAGGGGATTCGCTGGACAGTGTGGAGGCCCTGATCAAAAAACACGAGGACTTCGACAAAGCCATTAACGTCCAGGAGGAAAAGATTGCTGCTCTGCAGTCCTTTGCCGACCAACTCATCGCCGCCGGCCACTATGCCAAAGGCGACATTGCTAGCCGGCGCAATGAGGTTTTGGACAGATGGCGACGTCTAAAAGCCCAGATGATTGAGAAGAGGTCAAAGCTGGGAGAATCGCAAACCCTGCAGCAGTTCAGCCGGGACGTGGATGAGATTGAGGCTTGGATCAGCGAAAAATTACAGACCGCGAGCGATGAGTCATATAAGGATCCCACCAACATCCAGAGCAAGCACCAGAAGCACCAGGCCTTCGAAGCAGAGCTACACGCCAACGCTGACCGGATCCGCGGCGTCATTGACACCGGCAACTCCCTGATTGAACGTGGGGCCTGTGCCGGCAGCGAGGATGCCGTCAAGGCCCGGCTGGCTGCCTTGGCCGACCAGTGGCAATTCCTGGTGCAAAAGTCCGCTGAAAAGAGCCAGAAACTGAAAGAAGCCAATAAGCAGCAGAACTTCAACACGGGGATCAAGGACTTCGACTTCTGGCTCTCTGAGGTGGAAGCCCTTCTGGCATCTGAGGATTACGGCAAAGATCTTGCTTCTGTGAACAACTTGCTGAAAAAACATCAGCTACTGGAGGCGGATATATCTGCCCACGAGGATCGCCTGAAGGACCTGAACGGCCAGGCAGACAGCCTGATGACCAGCAGTGCCTTCGACACCTCCCGAGTGAAAGACAAGCGGGACACCATCAACGGTCGTTTCCAGAAGATCAAGAGCATGGCGGCCTCCCGGCGAGCCAAGCTGAATGAATCCCATCGCCTGCACCAGTTCTTCCGGGACATGGATGACGAGGAGTCCTGGATCAAGGAGAAGAAGCTGCTGGTGAGCTCTGAGGACTATGGCCGAGACCTAACAGGTGTGCAGAACTTGAGGAAGAAGCACAAACGGCTGGAGGCAGAGCTGGCCGCGCACGAGCCTGCGATTCAGGGTGTCCTGGACACTGGAAAGAAGCTGTCTGACGACAACACCATCGGGAAGGAGGAGATCCAGCAGCGTCTGGCGCAGTTTGTGGAGCACTGGAAAGAGCTGAAGCAGCTGGCGGCGGCTCGGGGCCAGCGGCTAGAAGAGTCCTTGGAATATCAGCAGTTTGTAGCCAACGTGGAAGAGGAGGAAGCCTGGATCAATGAGAAAATGACGCTGGTGGCCAGTGAAGATTATGGGGACACTCTGGCTGCTATCCAGGGCTTACTGAAGAAACACGAAGCTTTTGAGACGGACTTCACCGTCCACAAGGACCGCGTGAATGACGTCTGCACCAACGGACAAGACCTCGTCAAGAAGAACAATCACCACGAGGAGAACATCTCCTCAAAGATGAAGGGCTTGAATGGGAAAGTGTCTGACTTGGAGAAGGCCGCGGCGCAGAGGAAGGCGAAGCTCGACGAGAACTCGGCCTTCCTCCAGTTCAACTGGAAAGCCGACGTGGTGGAATCCTGGATCGGTGAAAAGGAGAACAGCTTGAAGACAGATGACTATGGCCGCGATCTCTCTTCTGTCCAAACTCTCCTTACCAAACAGGAAACCTTTGATGCTGGCCTGCAGGCCTTCCAGCAGGAGGGCATTGCCAACATCACTGCCCTCAAGGATCAGCTGCTGGCCGCCAAGCACATTCAGTCAAAGGCCATCGAGGCCCGGCACGCCGCCCTCATGAAGAGGTGGAGCCAGCTTCTGGCCAACTCAGCCACCCGGAAGAAGAAGCTGCTGGAAGCTCAGAGTCACTTCCGCAAGGTAGAGGACCTCTTCCTGACCTTTGCCAAAAAGGCTTCTGCCTTCAACAGCTGGTTTGAAAACGCAGAGGAGGATCTGACAGACCCAGTGCGCTGCAACTCCCTGGAGGAGATCAAAGCCCTGCGAGAGGCCCATGACGCCTTCCGCTCCTCGCTCAGCTCCGCCCAGGCCGACTTCAACCAGCTGGCCGAGCTGGACCGCCAGATCAAGAGCTTCCGCGTGGCCTCCAACCCCTACACCTGGTTCACCATGGAGGCCTTGGAGGAGACCTGGCGGAACCTGCAGAAGATCATCAAGGAAAGGGAGCTGGAGCTGCAGAAGGAGCAGCGCCGGCAGGAGGAGAATGACAAGCTGCGCCAGGAGTTCGCCCAGCACGCCAACGCATTCCACCAGTGGATCCAGGAGACCAGAACGTATCTCCTCGATGGGTCCTGCATGGTGGAAGAGTCCGGGACCCTCGAATCCCAGCTCGAAGCTACCAAACGCAAGCACCAGGAGATTCGAGCAATGAGAAGTCAGCTGAAGAAGATTGAGGACCTGGGGGCAGCCATGGAGGAAGCCCTGATCCTGGACAACAAGTACACGGAGCACAGCACGGTGGGTCTGGCCCAGCAGTGGGACCAGCTTGACCAGCTGGGCATGCGCATGCAGCACAACCTGGAGCAGCAGATCCAGGCCAGGAACACGACAGGAGTGACCGAGGAAGCCCTCAAGGAGTTCAGCATGATGTTTAAACACTTTGACAAGGACAAATCTGGCCGCCTGAACCACCAGGAGTTCAAGTCCTGCCTGCGCTCCCTGGGCTACGACCTGCCCATGGTGGAGGAAGGGGAGCCTGACCCAGAGTTTGAGGCGATTCTGGACACTGTGGACCCGAACCGGGACGGGCACGTCTCCCTGCAAGAGTACATGGCTTTCATGATCAGCCGAGAAACGGAGAATGTCAAGTCCAGCGAGGAGATCGAGAGCGCCTTCCGGGCCCTGAGCTCCGAGGGCAAGCCCTACGTGACCAAGGAGGAACTGTACCAGAACCTGACTCGGGAACAAGCAGACTACTGCGTCTCCCACATGAAGCCCTATGTGGACGGCAAGGGCCGCGAACTCCCCACTGCTTTTGACTATGTCGAGTTCACTCGCTCGCTCTTCGTGAATTGATCCTCCCGCTCCTTGGTTAGCCCGGCCCAGCTGCTTGCCCTGCCGTCGCCTTGCTGCATGTCACCTCCTCTGTGCTCTTCAAAATATTCCAGACAGTGTTACTTTCCAATGTAACTTTAAATTTGCTTAGCTTGGGATAGGACTTAGTAGAAAATGGTGCTTCAATAAACTGCTTCTGGTCCAGTTGCAAACGCCACGTTGCTGTGGGGACCCAGATTCCTGTCTTGAAGCCAGCTGCCCCATTCCAGCTTCAGAAAAATCTAGGCAGCTGTCTCGTTTCCCTGTCCTTTACCACCCCCACCATTTCGTTTTCATGTAATAGACAAATAAATGACACCTCTCCCCCAA