Transcript asmbl_45782

Sequence
Transcript Sequence for observation asmbl_45782 of TGE0005904:
GGCGGCCGCTTCCCGCCCCCGAGCGCGAGCCGGTTCCGAGCGGAGTGGAGCGGAGGTCGGACCCGGAGCGGAGCCGGCTGAGCGGGCGCTGAGCCCCCGCCATGGCCCGGAACACGCTGTCCTCGCGCTTCCGTCGGGTGGACATCGACGAGTTTGACGAGAACAAATTTGTGGACGAGCAGGAGGAGGCGGCGGCGGCGGCGGGCGAGCCAGGCCCGGACCCCAGCGAGGTGGATGGGCTCCTGCGGCAAGGGGACATGCTTCGGGCGTTTCACGCAGCCTTGAGGAACTCTCCTGTCAACACCAAGAATCAAGCCGTGAAGGAACGAGCCCAGGGCGTGGTGCTGAAAGTGCTTACAAATTTTAAGAGCAGCGAAATTGAGCAGGCTGTGCAGTCACTGGACAGAAATGGCATTGACTTGCTAATGAAGTACATTTATAAAGGGTTTGAGAAGCCCACAGAAAATAGCAGCGCAGTGTTACTCCAGTGGCATGAAAAGGCGTTAGCAGTAGGAGGACTAGGCTCCATTATAAGAGTTCTTACAGCAAGAAAGACTGTTT