Transcript asmbl_45648

Sequence
Transcript Sequence for observation asmbl_45648 of TGE0022177:
GTGGGGGCGGCGGGACCCGGAAGGGGAGCGGCCGCAGGAGCCGGCGGGGCAGCTACGCGGGGTCCTCGCGCGCTTCCCACGTGGGCTCGGGCGGAGACGCGGTCTCGGCCCGCGCGGTCCAGACGTACTTGGCTCGCCTGCGTGTGGCCGCGGTTGCGCGTCGACCATGGCGGTTACCGACGGATTGCTTCTCCACCTTTCCGAGCCCCCAGCCGCCGCCGCCGCCTTCAGGACGTTCTCCAGACCCCGCGTGGCCCAGGCGAGGCGGCAAGCACAGGCCACCAAAAGGAAGTACCAAGCATCCAGCGAGGTTCCCTCAGCGAAGCGGAGGAGCAGGGCATCCTCTCTGCCCGCTAAGAAAACCACCGCGGAAGGAGTGCAGAGGGCTCCCGAGGGGAGGGCGCAGACGGCGTCTTCCCCGCGGAGGTCTTCGGCCGGCGGCAGGGGTAGGAACCAAGAGCAGAAGCCATGCGTTAAGACCTCCTCGTTGTTTAAAAACAACCCCGAGATTCCAGAACTCCACAGACCCGTCGTACAGAAGGTGCAAGAAAAGGTGTTCTCTTCAGGTGCTTTTCATGACCTGGACCTCCACCCTCATTTGATTTCCACAATAAACACAGTCTTAAACATGTTCAACATGACCAGTGTTCAGATGCACAGCATTCCCGTGCTGCTGGAAGGCAGAGATGCCCTCGTGAGATCGCAGACCGGCTCAGGTAAAACTCTTGCCTATTGCATCCCTGTGGTCCAGTCCCTTCAAGCAATGAAAACGAAAATACAGCGCAGTGACGGCCCCTATGCTCTGGTGCTGGTGCCCACGAGAGAGCTGGCTCTACAAAGCTTTGACATCTTCCAGAAACTTCTCAAGCCGTTCACTTGGATTGTGCCCGGAGTGCTCATGGGAGGCGAGAAGAGAAAATCGGAAAAAGCCAGACTCCGCAAGGGAATAAATATCCTTATCTCAACTCCGGGGCGACTGGTGGATCACATCAAATCCACAAAGAACATTCATTTTAGCCGGGTACAGTGGCTGATTGTGGATGAAGCCGACAGAATCTTGGATTTGGGTTTTGAGAAGGATATCACAGTGATACTCAATGCAGTCAATGCCGAGTGTCAGAAGCGACAGAACGTCTTGCTGTCGGCGACACTCACGGAAGGGGTGGCCCAGCTCGCCGATATCAGTTTACTCAACCCAGTCAGTATTTCTGTCCTGGAAGAAGGCTACGGACAGGCTAACCCACAGGGCGGAGGAGCTCTTGAAGTCTCCGCTCCACAAACCAGCGACGAGTTGGACAGCTTCGCGATACCGGAGGGTCTCGATCAGCACGTGACCTTGGTTCCCAGCAAACTGAGGCTGGTCTCCCTGGCGGCCTTCATCCTGCAGAAGTGCGCGTTCGCAGCCGACCAGAAGATGATCGTCTTTTTCCCGAGCTGCGAGCTGGTGGAGTTCCACTACACGCTCTTCGTCCAGACCCTGCTGCCCCGCCCGGGAGCCCCGGCCGCGGCGCCCTTACCATCCGGCTCCACGCAGTTGAAGTTCCTGCGGCTGCACGGGGGTCTGGAGCAGGAGGACAGAATAGCCGTGTTTCAAGAATTCTCCCATTCCAGAACGGGCGTTCTCCTTTGCACGGACGTTGCGGCTCGGGGCTTAGATCTCCCTCAAGTCACGTGGATTGTTCAGTACAACGCTCCGTCTTCGCCGGCTGAGTACGTCCACCGGGTTGGGAGAACTGCCCGCATTGGCTGCCGGGGGAGCAGCCTGCTCATTTTGGCTCCTTCGGAGGCAGAATATGTCAACTCGTTGGCTTCTCACAAAATCAATGTTTCCGAGATTAAGATGGAAGATATTTTGTCTGTTCTGACAAGGGATGATTGTTTTCCGGGGAAGCAGTGGGGAAAGCAGAAACCCCGTGCCTTGAGCCCCCAGGGGATCCGAGAGCGAGCCACGGTCTTGCAGACGGTGTTTGAAGATTACGTGCACTCCAGTGAGCAGACGGTCTCCTGGGCAAAGAAAGCCCTGCAGTCCTTCATCCGTGCCTACACCACCTACCCCCGAGAGCTGAAGCACATCTTCCACGTTCGGTTGCTGCACCTTGGGCACGTGGCTAAGAGCTTCGGGCTAAGAGATGCGCCCCAGAATCTTAGCGTCTCGGCCGTAAAAAAGAAAAAAGCCGCCCCGAAAAGGCCTGACCTTCGGAAGAAGACCCAGAGTAAGCAGCGCCTTGCTGAAATCTTGCGTTCCGAATACGCAAGCGGGATGGAGGCTGGCATGGCCAAGGTCAGAAAGCAGAGCAAACAGGCCGACCAGGCAGCCGGCCGAGCGGCACGTCCGAGACCCGAGCCCGGCCTGGGCCGTGGGAAAAAGCAAAAGAAAAAACGCTCTCCGTGAAGGAGAGAAACCCAGAAAGGCTTACGAGGGACGAGACTCCCCAGAAAGTTGCTCTAAACTCTTCCTCCCCAGGACCGGGCCTGTGGCCCTGGTGGCACTGGATCGATGTCCCGCTCTCTTTTCAGAGGAGCCTTGGGACACGTACCAGTGCCACCTGTCCCTGATGACGGGCGTCCCTGCCACAGAGCGGCCACGGCCCCGTCTCCCACGGGGAGGGGTCAGCGGGGCAGGGAGTCAGTGGTTAGCCTGTGTCTTACAGCAGACACCTCACATCTTGTGTTCATTCTGTCAGCGCCCACACCTGCTTCACCCGTAGATCAGATGGTGCCCCCACGACTTAGTGCCTAAGCCTTGTCCTTACGTCAGCCAGGAGAGGCTGCGACCTGCCTGGTGACACGATCTGAAGAAATGTCTGTGTTCCTTTCTCCCGCCCCATCAGCGCCCATATGGGCGTGAATTTTGTAAAGTAAGATATCAAACTCCGGACTTCAATTTGTCAAAGAAGAAAATATTTATCAGATCACCTTCTCGATGTCTAAATGCTCGTGAGAGAGGATGGAAGGGGTTCGGGTGTGAGTCCCCGCGGTCAGCCCTCCTGGTTCCCGTCCGGGCTGCCCCCACCTCCAGACCACATGCGCAGGCATTGCTGGTGCCCCCCACATCCACGGAAAACTGATGCTCAGGACTAATTGACTTGCTGTCGCCGTTTTATCATTCGCCTTTGAAGTCAAAGGCTCCAGTGTCCTGAGCTTTTTCTCTCATGGAATCCGGTCCCCTCCAAGAAAGGCCTGAGGTCTTTGTACTGTGGCCCAGGCCACAGCTGCCCCGCCCCCATTGTGTTTCCTGGGAAGTTTGAAAGGGACCCCCAGGGCGTATTGATTTCCCAATAAATGTAAGATTTGGACACGGGTGACCGCAGAGGGTGCGGGGAGGTG