Transcript asmbl_45599

Sequence
Transcript Sequence for observation asmbl_45599 of TGE0005882:
GAGATATGGCCCCTCCCCTTCCCGGGATGTCGGAAGAAACCCGACAGAGCAAATTGGCCGCGGCCAGGAAAAAGTTAAGGGAATATCAGCTGAAGCAAGGCTGTCTTCCTACAGGACCTAAGAAGAAAAAGAAGATTAAAAATGGCAATAACCCTGAGACACCCACTTCTCATGAGTGTCACTCAGCCGAAGATGCGCCCAAAGACTGCGCCGCTCCTGCAGCACCACCTGCTGATGACACCATGTCACCTGGCGGTGTCATTTCCCCCTGTGCTGGTCCCTCCCATGTCACTAGCATGGCATCAACTCAGAACCATGACGCTGAAAATGGTCCTAGTCCCATGGATGGAAGCAAATTCTCATCTACCGAGAGCCTACGTCAGCTTTCTCAGCAGCTCAACGGTCTTGTGTCCGAGTCTACATCCTACATCAACGGGGAGGGCCTAGCATCTTCTGCTAACATAAAGGCTCTGGAGAGCCGGTATCAAGAGCTATCTCTAGCCCTGGACTCCAGCAATCTAACAAACAAACAACTCATTAGCAAGATAGAGGAATTGAAACAACAGAACCAGGAAACTGTGGATCAACTGGAAAAAGAGAAGGCAGAATGTGAGCAAAAGCGCTTGAAGGAGCAGGGGGCTCTGAGAGAGCAGCTGCAGGTTCATATCCAGACCATCGGGATTCTAGTATCTGAGAAGACGGAATTACAGACGGCCCTGTCCCATACCCACCAGGCAGTCAGGCACAAAGCAGGAGAGGTGGAGGATCTTATCTGTCGCCTGAAGTCTTCCCGGCAGCGCATCGCTGAGCTGGAGCGGACGCTGTCTGCTATCTCCACGCAGCAGAAACAGGCGGACAGGTACACCAAGGAATTAACCAAAGATCGAGATACCCTCAGGCTGGAGTTATACAGGAGCAACAAAGCCAATGAGGACCTGAAGCAGCAGAACTCAGAACTGGAGGAGAAGCTTCGGGTCTTGGTGACTGAGAATTCGGCTATGCAACTCAGGTTTGAGGAGTCGCAAAAAAAGCTGGAGATGTCAGAGCTGCTGGTGCAGCAGCTTTCCAGTCAGTCTGAAACCTCTGATAGCAAGCAGCAGTTAGAGCAGGCCCTTTTTTTTCAAAGCTGGAGGCACATGTGGAGCAGTTGAAGGATTTGCTGAAGCAACTGCAGATGGAGAGAGACCAGTACGCGGAGAATCTGAAAGAAGAGAATGCCATTTGGCAACAGAGGATGGAGCAGATGTCAGAGAAGATGTGCAAGTTGAGGGAGGAGAAGGAGCAGAGCGTGAGTCAGGTGCAGGAGCTGGAGACCAGGTTGACTGAACTGAGGAACCAGATAGCCGTTCCCCCACCCCAGCAGCCCCCAGCAGGGCCTTCGGAGATGGAACAGCGGCTGGAAGCCGAGGCCAGGCAGCTACAGAAGGAACTAGAGAGCCTGGCGGGGCAGCTGCAGGCCCAGGTGCAAGACAACGAGGGTCTGAGCCGTCTGAATCGGGAGCAGGAGCAGCGGCTGCTGGAGCTGGAGCAGGCTGCCGAGCGCTGGGGCGAGCAGGCGGAGGAGCGCAAGCGGGTGCTGGAGACCATGCAGAGCGACCGCACGACCATCAGCCGCGCTCTCTCCCAGAACCGGGAGCTCAAGGAGCAGCTGGCCGAGCTGCAGAACGGCTTTGTCAGGCTGACCAACGAGAACATGGAGATTACCAGCGCGTTTCAGTCGGAGCAGCATGTCAAGAAGGAGCTGGCCAAGAAGCTGGACCAGCTGCAGGAGAAGCTGGAGGAGCTGAAGGAGACGGTGGAGCTGAAGAGCCAAGAGGCCCAGAGTCTGCAGCAGCAGCGGGACCAGTACCTGAGCCACCTGCAGCAGTATGTGGTCAGTTATCAGCAGCACGTGGCCGCCTACCAGCAGCTGGCCTCCGAGAAAGAGGTGCTGCACAAACAGGTCCTGCTACAGACCGAGCTCATGGACCAGCTACAGCATGAGGAAGTTCAGGTCAAGATGGAGGCCGACATGGCCCGCCAAGAGTTGCAGGAGACCCAGGAGCGCTTGGAAGCTGCCAACCAGCAGAATCACAATCTACAGGCCCAGCTGAGCCTCATGGCTCTGCCTGGGGAAGGAGACGGAGTGGACATTGAGGAGGAGGACAAAGAGGCTCCCCGGCCAAAGCTGAGCATGCCGGAGGACCTAGAGAGCCCAGAGGCCATGGTGGCATTTTTTAACTCGGCCTTAGCCAGTGCTGATGAAGAGCAGGCACGGCTGCGTGGGCAGCTCAAGGAGCAGAAGCTGCACTGCCGGCGCCTGGCTCAGCTGGCAGCCCCGTCCCAGCACCCGCTGGAGGGGGAGGCCCCAGCCCCCCGCACTGGGGGAAACGGTGTGCCCGCAGAGAGGCACCAGGCCCTCCAGGTGGCCATGGACAAGCTGCAGGGCCGCTTTACAGAGCTCATGCAGGAGAAAGTGGACTTGAAGGACCGTGTAGAGGAGCTGGAGCATCGCTGCATCCAGCTGTCTGGAGAGACGGACACTATTGGAGAGTACATCGCCCTGTACCAGAGCCAGAGGGCTGTGCTGAAGGAGCGGCACCGGGAGAAGGAGGAGTACATCAGCCGGCTGGCTCAGGACAAGGAGGAAATGAAGGTGAAGCTCCTGGAGCTGCAGGAGCTGGTGTTACGCCTGGTGGGCGAGCGGAATGAATGGTATGGCAAGTTCTTGGCGGCTGCCCAGAACCCTGCTGGTGAGCCCAGTGCAGTGGCCCCGGCCCCCCAGGAGAATGTTGCTGCTGACAGCCAGGGTGATCTCCATGAAGTGAGCCTTGCTGACAATGTGGAGCCTACTCAGGGAGAGGCCCTGCCGGGCCTGGCTACTCCCCCTGAGAACCCCACCGCACAGCAGATTATGCAGCTGCTGCGAGAGATCCAGAACCCCCAGGAGCGCCCAGGCTTGGGCAGCAACCCCTGCATCCCCTTCTTCTACCGGGCTGATGACAATGACGAGGTGAAGATCATGGTCATCTAACGCCTGACACTAAAAGACAAAGCTTGGAGAAGTGGGGCTGGGGCTCTGTCCCCTGCTCTCTGTCCCTTTTCCTCCTTTCCTGGCACCCTTTCCAGGTCAACCCTTCCAGGTCACCCTTTTATCCCTAGACTAGCAAGATAGGGCCCCCGAAAAAGGGGTATGATGACCCCCCTGCCTACTTGGGGGAGAAACAGGTATAGGCCCCTTGGCCCCTTGGCCAAGGCTGTCTTAATCTCTGGGCTGCTACTAGTTCCAGAAAAACAAAGAGCCAGAAGTGCAGTAAAGGTAGTTTATTTTAAGAGGCTACCTCTCTCGGGGAGCAGGGGCTCCCTGGTGGCCTCCTTACCCCTGCCAAGCGGTCCTTCATTTAGAGGGGCTCATGCATCCTCTGCTCAGAGGCACTTTGGGGCACAAGTGCCCCCCTTGTCCAGGTATACAACTGGGCAGCACTCTCACAGGCCTTGGGACAGTTGGGGCTAACCAAGGCCAGCACAGGCGTAAGCTCCCTCTCCAGTGTACATACTATATCTATGTAACATTTTGTATATTCCAGGGGTAGGGCAGCCCCCTGTATCATAGCAGAGGTCGGAGCTGGCAGATGGGGAGCAGGTTCTATTAAATATTTGGGGTTGGGGGAACTTATTTATTGATAGCATAGGACAGAGGAAGGAGGCAGGGATAGGGTGGTGCCCAGGTGATTCGACTCCTGTTTGTTTTACTTTTTATTTCAGAATAAATGAATTTAG