Transcript asmbl_45572

Sequence
Transcript Sequence for observation asmbl_45572 of TGE0022161:
GGGCACACACTGGCCCCGGTGCCCACCCGCACCCCACCCCCAGAGCGCTGACTCGGCTCCCCGGACCTCGGCAGGATGGAAGAGAAGCTGAAGAAAACCAAGATCATCTTTGTGGTGGGCGGGCCCGGCTCGGGGAAGGGCACCCAGTGTGAGAAGATTGTCCAGAAGTACGGCTATACTCACCTTTCCACCGGGGACCTCCTGCGGGCCGAGGTCAGCTCGGGCTCGGCCAGGGGCAAGATGCTGTCGGAAATCATGGAGAAGGGGCAGCTGGTGCCGCTGGAGACAGTGTTGGACATGCTCCGAGATGCCATGGTAGCCAAGGTAGACATTTCCAAAGGCTTCCTGATCGATGGCTACCCTCGGGAGGTGCAACAGGGGGAAGAGTTTGAGCAGAGGGCCCCGAGACCATGACCAAGCGGCTCCTGAAGCGGGGAGAGACCAGCGGGCGTGTGGACGACAACGAGGAGACCATCAAGAAGCGGCTGGACACCTACTACAAGGCCACAGAACCTGTCATTGCCTTCTATGAGAAACGTGGCATCGTGCGTAAGGTCAATGCCGAAGGCTCCGTGGACAGTGTCTTCTCCCAGGTCTGCACCCACCTAGACGCCCTCAAGTAGCAGCGCCGGAGCCCCTTCCCCAGCTCAGAGCCCCACCCCACCCCTGTCCTGACTCAAGAACCCTGGCCTGAGCTCAGCGCCTCCGCCCTGCCCGCTGGAGCACAGACAGAGGAAGCCACTTTATCCTGTTTTCATGGACAGCTGAGCACTAAAGGAATTTCCGAGGACATTCGGTTTTACTCCTTTTTCTTTGCTTCCATCGGGGTTGATTCATGTGGGGTGGCCGCCCTGGCCTCGAGCCCCTCACCCTCCCCATTCCTCCTCAGGTCCCTCAGCCCACCTTGGCCGGCCGCCCCTCCCCAGTAGAAGGTCCCCTTCCTCACACAGGGTGTGCCGAGCTCAGACTGGGCCAGGCCTGGGGAGCCAGGGTCCTTGCTTTCTGGGACTCGTGGTCAGACAGAGCTGGGCCCTGGCCTGGATTCCTCTGCATTCTTGCTGTGTGGACTTGGCCCTGACCCCTCCTGTCTCTGAGCCCGTTTTCTGTGCCTAACCTCCTCTGGGGACTGAGCCATAGCAGGCAACAAGGTCATGGGCAGCGTGGGGCTCCCTGGTGGTGGGGGCAGCACACGTCGGCAAGCCAGGTGGGCAGGAAATTGGCCACCTTGGTACAAGAAGCCCCGAGGGTCTGAAAAGGACATCAAGAGTGAATGGGGGGAAGG