Transcript asmbl_45563

Sequence
Transcript Sequence for observation asmbl_45563 of TGE0005877:
CAGAGAAAACTAGGAAGATCCTGACGGAGTTCCTTCGTTTTTACGAGGACCAGTATGGTGTCGCCCTTTTCAACAGCATGCGCCACGAAATCGAGGGCACCGGGGTGCCGCAGGCCCAGCTGCTCTGGCGCAAGGTGCCGCTGGATGAGCGCATCATCTTCTCGGGGAACCTCTTCCAGCACCAGGAGGACAACAAGAAGTGGAGGAACCGCTTCAGCCTCGTGCCCCACAACTATGGGCTGGTTCTCTACGAGAACAAAGTGGCGTATGAGCGGCAGGTCCCACCCCGAGCTGTCATCAACAGCGCAGGCTACAAAATCCTCACATCCGTGGACCAGTACCTGGAGCTCGTTGGCAACTCCTTACCAGGGACCACCTCGAAATCGGGCTCCGCCCCCATCCTCAAGTGCCCCACGCAGTTCCCACTCATCCTCTGGCATCCTTCTGCACGACACTACTACTTCTGCATGATGACAGAAGCCGAGCAGGACAAGTGGCAGGCTGTCCTGCAGGACTGCATCCGGCACTGCAACAACGGGATCCCCGAGGACTCCAAGGTGGAGGGCCCTGCGTTCACGGACGCCATTCGCATGTACCGCCAGTCGAAGGAGCTGTATGGCACCTGGGAGATGCTGTGTGGCAACGAGGTGCAGATCCTGAGCAACCTGGTGATGGAGGAGCTGGGCCCTGAGCTGAAGGCGGAACTTGGCCCCCGGCTGAAGGGGAAACCACAGGAGCGGCAGCGGCAGTGGATCCAGATCTCGGATGCTGTGTACCGCATGGTGTACGAGCAGGCCGCAGCGCAGTTTGAGGCGGTGCTGTCCAAGCTGCAGCTGGCCCGGCCGGCCATGGAGGCGGTCATCCGCACCGACATGGACCAGATCATCACCTCCAAGGAGCATCTGGCCAGCAAGATCCGAGCCTTCATTCTCCCCAAGGCGGAGGTGTGTGTCCGGAACCACGTTCAGCCCTACATCCCGTCCATCCTGGAGGCCCTCATGGTGCCCACCAGCCAGGGCTTCACGGAGGTGCGGGACGTCTTCTTCAAGGAGGTCACCGACATAAACCTGAACATCATCAATGAGGGCGGCATCGACAAGCTGGGCGAGTACATGGAGAAGCTGTCCCAGCTGGCGTACCACCCCCTCAAGATGCAGAGCTGCTACGAGAAGATGGAGCCGCTGCGGCTTGATGGTCTGCAGCAGCGTTTCGACGTGTCCAGCACGTCCGTGTTCAAGCAGCGAGCCCAGATCCATATGCGTGAGCAAATGGACAATGCCGTGTACACCTTCGAGACCCTCCTGCACCAGGAGCTGGGGAAGGGGCCCACCAAGGAGGAGCTGTGCAAGTCCATCCAGAGGATCCTGGAGCGGGTGCTGAAGAAATATGACTATGACAGCAGCTCTGTGCGGAAGCGCTTCTTCCGAGAGGCATTGCTGCAGATCACGATCCCATTCTTGCTCAAGAAGCTGGCCCCCACCTGCAAGTCGGAGCTGCCCCGGTTCCAGGAGCTGATCTTCGAGGACTTCGCCAGGTTCATCCTGGTGGAGAACACGTACGAGGAGGTGGTGCTGCAGACGGTCATGAAGGACATCCTGCAGGCCGTGAAGGAGGCCGCTGTGCAGAGGAAGCACAACCTGTACCGGGACAGCATGGTCATGCACAACAGCGACCCCAACCTGCACCTGCTGGCCGAAGGCACGCCCATTGACTGGGGTGAGGAGTATGGCGATGGTGGTGGCAGTGGCGGCAGCAGTGGGAACAGCGGTGATCCCAGCCCCAGTGTCCCAGAAGCAGCCACCACCTCAGAGAAACAACGGCGTGCCAAGCAGGTGGTGTCCATGGTCCATGACGAGGCAGGGCTGCCCTTTGAGGCTGGCCCTGAGCTACTATCACCTGCATCCCTGGACAGTGTCACCGAGCTCCGTGGCCTGCTGGCCCAGGATCTGCGGGCTGAGAGCCCCCCGCCGGCCGGACCCCTGCTCAACGGGGCCCCTCTGCGGGAGAGCTCCCAGCCTGTGGCCACCCCCGAGGCCTCACCACCTGCCTCGCCCCTCCGGCAGCTCCCGCCTGGAAAGGCTGTGGACCTTGAACCTCCCAAGCCCAGTGACCAGGAGACCGGGGAGCAGGTGTCTAGCCCTGGTGGCCGCCCTGCCATCCACACTACCACCGAGGACAGTGCGGGGGTGCAGACTGAATTCTAGGCTGGTCGCCCCCGAGCTTCTGTTGGACAAGGCACATGGGCCCCTCCCTCCAAGGCACTGGCAGGCTTGGCTCCAGGCGGGAGTGCCAGATCTGTGTCTCCGGGTGGAGGTGGGGCAGGGCTAGTATGCGTCTGGGGCTGGGCAGGGACGGCCCACCTGAGTCACTTTATTGGGTTCGGTCATACTTTGTTGCTCCGTTTTCTTTTCTGTGGGCTGATCTCAGCTTTCCTCCTTGTGCTGGGGGCTGAGCAGAGATGAGGGGGCTGGGAAGCTCTCAGTGGCCCCGATTCTCTGGGTCCTCCCTTCCTGCCCTTCCTCCGTGGCCTGCCTCCCTCGTGGGTCTTGCCATCCTTGCAGAGGGAGGTAAAGGCTTTGTCTGCTGTGACTCAGCCCTTGAATTCTCTGCCCTCGCCAAGGGCTCATTGGAACTGGGAACATGTAGCGCTGAGGCCCATCTTGGTCGCACTCCCCTCCTGCTCTCCCTGGCTGGGCCCACTGGCCAGTGTCAGAGTGGACACTGGCCTCACCTTTCCGATCCCGGGTGAGGGGAGGTTCAAGGAGGGGGTCTTCGGGCTAGAGTCAGGCTGGGG