Transcript asmbl_45562

Sequence
Transcript Sequence for observation asmbl_45562 of TGE0022160:
CACAGGCTGCCAACTGCTCCCGGGAAGGCCTGGGGTGGCCGGCTGAGGAGCCCCTCGGAGGTGTGCAGGAGGGGCTGTGGTCACTCTGGAACCTTCACGTGCCCTATGGTGTGTCCTATAGCAAATGGACAATGCCGTGTACACCTTCGAGACCCTCCTGCACCAGGAGCTGGGGAAGGGGCCCACCAAGGAGGAGCTGTGCAAGTCCATCCAGAGGATCCTGGAGCGGGTGCTGAAGAAATATGACTATGACAGCAGCTCTGTGCGGAAGCGCTTCTTCCGAGAGGCATTGCTGCAGATCACGATCCCATTCTTGCTCAAGAAGCTGGCCCCCACCTGCAAGTCGGAGCTGCCCCGGTTCCAGGAGCTGATCTTCGAGGACTTCGCCAGGTTCATCCTGGTGGAGAACACGTACGAGGAGGTGGTGCTGCAGACGGTCATGAAGGACATCCTGCAGGCCGTGAAGGAGGCCGCTGTGCAGAGGAAGCACAACCTGTACCGGGACAGCATGGTCATGCACAACAGCGACCCCAACCTGCACCTGCTGGCCGAAGGCACGCCCATTGACTGGGGTGAGGAGTATGGCGATGGTGGTGGCAGTGGCGGCAGCAGTGGGAACAGCGGTGATCCCAGCCCCAGTGTCCCAGAAGCAGCCACCACCTCAGAGAAACAACGGCGTGCCAAGCAGGTGGTGTCCATGGTCCATGACGAGGCAGGGCTGCCCTTTGAGGCTGGCCCTGAGCTACTATCACCTGCATCCCTGGACAGTGTCACCGAGCTCCGTGGCCTGCTGGCCCAGGATCTGCGGGCTGAGAGCCCCCCGCCGGCCGGACCCCTGCTCAACGGGGCCCCTCTGCGGGAGAGCTCCCAGCCTGTGGCCACCCCCGAGGCCTCACCACCTGCCTCGCCCCTCCGGCAGCTCCCGCCTGGAAAGGCTGTGGACCTTGAACCTCCCAAGCCCAGTGACCAGGAGACCGGGGAGCAGGTGTCTAGCCCTGGTGGCCGCCCTGCCATCCACACTACCACCGAGGACAGTGCGGGGGTGCAGACTGAATTCTAGGCTGGTCGCCCCCGAGCTTCTGTTGGACAAGGCACATGGGCCCCTCCCTCCAAGGCACTGGCAGGCTTGGCTCCAGGCGGGAGTGCCAGATCTGTGTCTCCGGGTGGAGGTGGGGCAGGGCTAGTATGCGTCTGGGGCTGGGCAGGGACGGCCCACCTGAGTCACTTTATTGGGTTCGGTCATACTTTGTTGCTCCGTTTTCTTTTCTGTGGGCTGATCTCAGCTTTCCTCCTTGTGCTGGGGGCTGAGCAGAGATGAGGGGGCTGGGAAGCTCTCAGTGGCCCCGATTCTCTGGGTCCTCCCTTCCTGCCCTTCCTCCGTGGCCTGCCTCCCTCGTGGGTCTTGCCATCCTTGCAGAGGGAGGTAAAGGCTTTGTCTGCTGTGACTCAGCCCTTGAATTCTCTGCCCTCGCCAAGGGCTCATTGGAACTGGGAACATGTAGCGCTGAGGCCCATCTTGGTCGCACTCCCCTCCTGCTCTCCCTGGCTGGGCCCACTGGCCAGTGTCAGAGTGGACACTGGCCTCACCTTTCCGATCCCGGGTGAGGGGAGGTTCAAGGAGGGGGTCTTCGGGCTAGAGTCAGGCTGGGG