Transcript asmbl_45552

Sequence
Transcript Sequence for observation asmbl_45552 of TGE0005876:
CGACGGGGCTGGGGGGAGGGTATATAAACGGAGTCGGGGACAGCGCGGTTGACGCTGGCCCAGACATCAGAGACCTACTGAATTCAGGATTTCGTGAGTGAGAACTGTCAGTAATCTCGGTGCGTTCCCGTCCTTCGGCCTGTGGCTGGATTGCTTGCGACGTCCTATCTACCTGCCTGCTGACTGACTGGCCGACAGCTCCGGCAAGATGAAGCTCTCCCTGGTGGCTGCGGTGCTGCTGCTGCTCGGCGCGGCGCGGGCCGAGGAGGAGGACAAGAAAGAGGACGTGGGCACGGTGGTCGGCATCGACCTGGGGACCACCTACTCCTGCGTCGGGGTGTTCAAGAATGGCCGCGTGGAGATCATCGCCAACGATCAGGGCAACCGCATCACGCCGTCTTATGTGGCCTTCACTCCCGAAGGGGAGCGTCTCATCGGGGATGCAGCCAAGAACCAGCTCACGTCCAACCCTGAGAATACGGTCTTCGACGCCAAGCGGCTCATTGGCCGTACTTGGAACGACCCGTCTGTGCAGCAGGACATCAAGTTTTTGCCTTTCAAGGTGGTTGAAAAGAAAACTAAACCATACATTCAAGTTGATATTGGAGGTGGCCAAACAAAGACATTTGCTCCTGAGGAAATTTCCGCCATGGTTCTCACTAAAATGAAGGAAACTGCTGAGGCTTATTTGGGAAAGAAGGTTACTCATGCAGTTGTTACTGTACCGGCCTATTTCAATGATGCCCAACGCCAGGCAACCAAAGATGCTGGAACTATTGCTGGATTGAATGTTATGAGAATCATCAATGAGCCTACAGCAGCTGCTATTGCTTATGGCCTAGATAAGAGAGAAGGGGAGAAGAACATCTTGGTGTTCGACCTGGGTGGTGGAACCTTCGATGTGTCTCTTCTCACCATTGATAATGGTGTCTTCGAAGTTGTGGCTACTAATGGAGATACCCATCTGGGTGGAGAAGACTTTGACCAGCGTGTCATGGAACACTTCATCAAGCTCTACAAAAAGAAGACTGGCAAAGATGTTAGGAAAGACAACAGAGCTGTGCAGAAACTCCGGCGGGAGGTAGAAAAGGCCAAACGGGCCCTGTCTTCTCAACATCAAGCAAGAATTGAAATTGAGTCCTTCTTTGAAGGAGAAGACTTCTCTGAGACCTTGACTCGAGCCAAATTTGAAGAACTAAACATGGACCTGTTCCGTTCTACCATGAAGCCTGTCCAGAAAGTGCTGGAAGATTCTGATTTGAAGAAATCTGATATTGATGAAATTGTTCTTGTTGGTGGCTCTACTCGAATCCCAAAGATCCAACAACTGGTTAAAGAGTTCTTCAATGGCAAGGAGCCATCCCGTGGCATAAACCCAGATGAGGCTGTGGCATATGGTGCTGCTGTCCAGGCTGGTGTACTGTCTGGTGATCAAGATACAGGTGATCTGGTACTGCTTGACGTATGTCCGCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCCAGGAACACTGTGGTGCCCACCAAGAAGTCACAGATCTTTTCTACAGCTTCCGATAATCAACCAACTGTTACAATCAAAGTTTATGAAGGTGAACGACCCCTGACAAAAGACAATCATCTTCTGGGAACTTTTGATCTGACTGGAATCCCTCCTGCTCCCCGTGGAGTCCCACAGATTGAAGTCACTTTTGAGATAGATGTGAATGGCATTCTTCGAGTGACAGCTGAAGACAAAGGTACAGGCAACAAAAATAAGATCACAATTACCAATGACCAAAATCGCCTGACACCCGAAGAGATTGAAAGGATGGTTAATGATGCTGAAAAGTTTGCAGAGGAAGATAAAAAGCTCAAGGAGCGCATTGATACTAGAAATGAATTAGAAAGTTATGCCTATTCTCTAAAGAATCAGATTGGAGATAAAGAAAAGCTGGGGGGCAAACTTTCCTCTGAAGATAAGGAGACCATGGAAAAAGCCGTAGAGGAAAAGATTGAATGGCTGGAAAGTCACCAAGATGCTGACATTGAAGATTTCAAAGCTAAAAAGAAGGAACTAGAAGAAATTGTTCAGCCAATTATCAGCAAACTCTATGGAAGTGCAGGCCCTCCCCCAACTGGAGATGAGGAACCAGTAGACAAAGATGAGTTGTAGACACTGCTCTGCTAGTGCTATGATGTTGTAAATACTGGACTCAGGAACTTTCGTTAGGAGAAAATTGAGAGAACTTAAGTCTCGAATGTAATTGGAATCTTCACCTTGGAGTGGAGTTGAAAATGCTATAGCCCAAGTGGCTGTTTACTGCTTTTCGTTAGCAGTTGCTCACATGTCCTGGGGTGGGGGGACAGGAAGAATTGGCTATCTTAAAAAGTGGGTAAAAAGGTTGGGTTACGGCATGTGTTCACCATGGAAAAATGTTCTATTTAACATTTGGGTCATGTGCATCTGGTGTAGGAACTTTATTTTCTACCGTAAGTGACATCAATAAATGTTTGTTATTTA