Transcript asmbl_44890

Sequence
Transcript Sequence for observation asmbl_44890 of TGE0022149:
GTGAGCACTTCCGGCGGCGCGGATTTCTCAGTGGTGCCGCTGTCCGGGGATCTTTCTGCCGAAATGAAGGACGTTCCCGGCTTCCTGCAGCAGAGCCAGAGCTCCGGGCCCGGCCAGGCCGCCGTGTGGCACCGCCTGGAGGAGCTCTACACGAAGAAGTTGTGGCATCAGCTGACACTTCAGGTTCTTGATTTTGTGCAGGACCCGTGCTTTGCCCAAGGAGATGGTCTCATTAAGCTCTATGAGAACTTCATCAGTGAGTTTGAACACAGGGTGAACCCTTTGTCCCTGGTGGAGATCATTCTGCACGTGGTCAGACAGATGACTGATCCTAACGTGGCTCTCACTTTTCTGGAAAAGACTCGTGAAAAGGTGAAAAGCAGCGACGAGGCAGTGATCCTGTGTAAGACGGCCATCGGGGCTCTCAAGTTAAACATCGGAGACCTGCAGGTTACAAAGGAGACGATCGAGGCTGTGGAGGACATGCTGCACAGCCTCCCTGGCGTGACGTCCGTTCACAGCCGTTTCTACGACCTGTCCAGCAAATACTACCAGACGGTCGGGAACCACGCGTCCTACTACAAAGACGCCCTGCGGTTCCTGGGCTGTGTCGACATCAGGGACCTGCCAGCGCCCGAGCAGCGAGAGCGAGCATTCACGCTGGGACTGGCGGGACTTCTTGGTGACGGAGTTTTTAACTTTGGAGAACTCCTCATGCACCCCGTACTGGAGTCTCTGAGGGGCACTGACCGGCAGTGGCTGATCGACACCCTCTACGCCTTCAACAGTGGCAACGTGGAGAGGTTCCAGACGCTGAAAGCCGCCTGGGGCCAGCAGGTCAGTCCCAGGCGGGCCCTGCACACAGTCACGTGTCCTCTGTTCACTGAGCAGCAGGGACTGAGGCATGCCAGTCTTCTGTCACCGTGGGAGGGTACAGCAGAAACTCCGGTAACATGGTCACCTGTAGCACCCAGTGCTGTGGACAGAACATGACGGGAGCATCATCTGTGCTGGGTAGAGGGGTGTTGCGGGTGTGC