Transcript asmbl_44551

Sequence
Transcript Sequence for observation asmbl_44551 of TGE0005842:
GGCCTCACTGAGTGCTGCCGGGAGCCGCCACGCAGCCATGGAGGAGGAGGAGGAACAGCCACCTCAGGAGGCCCACGCAGAACCCCCTGTGACGTCAGGAGCGTCGGAGGTGGTGCCCAGGGTGCTTTCCGGAGAACCCCAGAACCTGTCTGACGTGGATGCTTTCAACCTGCTGCTGGAGATGAAGCTGAAGAGGCGGCGAGAACGGCCCCACCTGCCACGCACGGTGACAGAGCTGGTGGCCGAGGACGGGAGCAGAGTGTATGTGGTGGGCACAGCCCACTTCAGCGACGACAGCAAGAAGGACGTCGTGAAGACGATCCGGGCGGTGCAGCCGGACGTGGTGGTGGTGGAGCTCTGCCAGTACCGCGTGTCCATGCTGAAGATGGACGAGCGCACGCTGCTGCGGGAGGCCCGGGAGGTCAGCCTGGAGAAGCTGCAGCAGGCCGTGCGGCAGAACGGGGTCATGTCTGGACTCATGCAGATGCTGCTGCTGAAGGTGTCGGCCCACATCACCGAGCAGCTGGGCATGGCCCCTGGTGGCGAGTTCAGGGAGGCCTTCAAGGAGGCCAGCAAGGTGCCTTTCTGCAAGTTCCACTTGGGCGACCGGCCCATCCCCGTCACCTTCAAGAGGGCCATCGCCGCGCTGTCCTTCTGGCAGAAGGTCAAGCTGGCCTGGGGCCTGTGTTTCCTGTCAGACCCTATCAGCAAGGATGACGTGGAGCGATGCAAGCAGAAGGACCTGCTGGAGCAGATGATGGCGGAGATGGTCGGCGAGTTCCCCGACCTGCACCGCACCATCGTCTCCGAGCGCGACATCTACCTGACCTACATGCTGCGGCAGGCGGCCCGGCGCCTCGAGCTGCCGCGCTCCTCCGACGCTGAGCCCAGGAAGTGTGTCCCCTCTGTGGTGGTGGGCGTCGTGGGCATGGGCCACGTCCCCGGCATCGAGAAGAACTGGACCACTGACCTCAACATCCAGGAGATCATGACCGTCCCCCCGCCGTCCATCTCCGGCAGAGTGTCCCGGCTGGCTGTGAAGGTCGCCTTCTTGGGCCTGCTGGGCTATGGCCTGTACTGGATGGGGCGCCGCACCGCTGGCCTGGTCCTCTCGCTGCCTGCCACCCAGTACTGCCTGCAGAGGGCGTCCTCAGCCCGGCCGCACAAGTAGGAGGCGCACAGGGAGCCGCCACGCCTGAGGGGCCGTCCCCACGGGTCCGGGCCCAGCCTCGCCTGCCCTCCCCCAGCCCACCCAAATAAAGAATTATTTAACTGCTCTGAGCTCAGGCTCCCCAGCCCGCCCCCAGGGGCTGCTCACGGGTTCTCGGGCACCAGGACAGGCATCCGGGAGGGCCGAGGCCACGCTTCCCCGCCAGTCCCTCCCTGCCCTAGGTGGTCGGGCACGCTGGGCCACAGCCGGCAGTCCCCTCCCTCACTGTGCCTTCGGCTGTGCGTCAGCGCCTGGAGCGCCTGGCCTGGCGGCTTGGGCTGGGAGGGCGAGAGCACCCAGGCTCTGGCCTGGCCCCTGGGAGTAGTCCTCCCAGGGGAGCAGCTTGGCCAAGCCTGGCGGCCTGGCGGCCGGATGTGCACCAGCACCGCTCTGCCTGCAGAGGTGTGTGTTCTTGGCTTTTAAAAATATCTGAAATTTTTTACTCAGGTAACTTTAACTTAAACAAAGTGAAGCAATGTCAGGAAATACGAGCCTTAAATCTGGTTGGGACAGGGAGGACGGCTTTCCCTCGGGATCCCCGAGAGAATGAGCGTGCAGGCAGGTCCAGC