Transcript asmbl_44065

Sequence
Transcript Sequence for observation asmbl_44065 of TGE0005816:
CAGGATTCTTTTGTAGAACTCTCTCTTGGAATGATATTTTCATCATGAGCCAACAAGGTTATGTGGCGACACCACCCTATTCTCAGTCCCAGTCTGGGATGGGCCTTTCTCCACCGCATTACGGACACTATGGGGACCCGTCTCATGCAGCTCCTCCCCCAGGCATGATGAAGCCGGCAGGGCCTCTGGGGGCCGCTGCACCAGGGGCGATGTCACCACAGGGCCCTCCACCTCCTGGACCCCATCAGTTCAGCCAGAACGGAGCGCACGCCCAGGGTCACCCTTCCCAAAGATTTCCAGGACCTCCACCTGTCAACAGTGCAGCACCCTCATATGCACCGTATTCACCTGCCACACAGTCATCTTACGCAAGCCCCATGCCCGCCCCATCCGTCTCCCAGCTGGGCAGTCAGCTCGGTGCCGTGCACATCAACAGCTATGGTAACCAGTCAGGTCCAGCCCCCTCCAGCCAGGGCCCCCCGGGCCCTCCGTCAGCGCCATCATTCCAGGGCCCTCCACAGCCACCGCCACCATCCATCCTGCAGCCTGGGCCTCAAGTCCTTCCGCCACCACCCACTGCGCTCAATGGCCCAGGGGCGCCACCCCTGCCTCCGCCCACGCACAGGCAGGACGGGCTCGCTGGGCCCGCTCCCGCGAGGGCCCCGCTGCAGCCCCCACCTCTCCTGGGACAGGCTGTGGCCGCCGGCTACCCTCCGCAGCCAGCCAACTACAGCCCACAGATGCCAGGGGCGCAGCTCTCGTTCCCAGGAGGCTTCCCTGCAGGGCCCGCACAGATGGCAGGGCCACCTCCGCCCCAGAAGAAGCTGGACCCTGACTCTATCCCCAGTCCAATCCAGGTGATCGAGAATGACAGAGCTGCCAGAGGGGGACAAGTGTACGCCACCAATACCAGAGGCCAGGTCCCTCCCCTGGTCACCACAGACTGTGTGGTCCAAGACCAAGGCAACGCTAGTCCTCGGTACATTCGCTGCACGACGTACTGCTTCCCGTGCACGTCCGACATGGCCAAGCAAGCGCAGATCCCGCTAGCCGCGGTCATCACGCCCTTCGCCACCATTCCTTCAAATGAGACTCCCCTTTACTTGGTGAACCATGGAGAGACCGGGCCGGTCAGGTGCAACAGGTGCAAAGCCTACATGTGCCCGTTCATGCAGTTCATAGAGGGAGGACGGAGGTTCCAGTGTGGCTTCTGCAACTGCGTGAGCGACGTCCCGCCGTTCTATTTCCAACATCTGGACCACATGGGAAGAAGACTGGACCACTACGAGAAGCCGGAGTTATCTCTAGGATCTTACGAATACGTTGCTACTTTGGATTACTGCAGAAAGAGTAAGCCTCCCAGCCCGCCCGCCTTCATCTTCATGATCGACGTCTCCTACAGCAACATCAAGAACGGGCTCGTGAAGCTCATATGCGAGGAGCTGAAGACCGTGCTGGACAAGCTGCCCAAGGAAGAGCAGGAAGAGACTTCTGCCATCCGCGTCGGCTTCGTCACATACAACAAGGCCCTCCATTTCTTCAATGTCAAGAGTAATTTGGCCCAGCCTCAGATGATGGTGGTGACCGACGTGAGCGAGGTCTTCGTCCCTTTGCTGGATGGTTTCCTTGTCAACTATCAAGAATCCCAATCTGTGATTCACAATTTGCTGGACCAGATTCCCGAGATGTTCGCGGACTCCGCTGAGAACGAGACTGTCTTTGCCCCTGTCGTCCGGGCCGGCATGGAGGCCCTGAAGGCGGCGGACTGCCCCGGGAAGCTGTTCGTCTTCCACGCCTCGCTGCCCACCGCCGAGGCCCCGGGGAAGCTGAAGCCCAGGGACGACAGGAAGCTGGTGAACACGGACAAAGAGAAGATGCTGTTCCAGCCCCAGACCAGCGTCTACGACTCGCTGGCCAAGGACTGCGTGGCCCGGCTGCTCCTTTTTTTTTCCCAGTCAGCACGTGGACGTGGCCTCCCTGGGCCTCGTGCCCCATCTCACTGGAGGGACCCTTTACAAGTACAGCAACTTCCAGATGCACTTGGATAGCCAGCAATTCTTGAATGACCTCAGAAATGATATTGGGAAGAAAATAGGATTTGACGCCATAATGCGGGTCCGCACCAGCACAGGATTTAGAGCCACTGATTTCTTTGGCGGAATTTTTATGAACAACACCACCGATGTGGAGATGGCGGCCATCGATTGTGACAAGGCAGTGACTGTGGAGTTTAAGCACGATGACAAACTTAGTGAAGACAGTGGGGCCTTAATCCAGTGCGCTGTGCTTTACACGACCGTCGGCGGTCAGAGGAGACTGCGGATTCACAACCTTGGCCTGAACTGCAGCGCCCAGCTGGCCGACCTCTATAAGAGCTGTGAGACGGACGCCCTCATCAACTTCTTCGCCAAGTCAGCTTTCAAAGCAGTCCTGCACCAGCCCTTGAAGGTCATCCGGGAAATTCTCGTTAACCAGACCGCCCACATGTTGGCCTGCTACCGGAAGAACTGTGCCAGCCCATCCGCAGCCAGCCAGCTCATTCTGCCGGATGCCATGAAGGTGCTGCCCGTGTACATGAACTGCTTGCTGAAGACCTGCGTGCTGCTCGGCCGGCCGGACGTCGCGGTGGACGAGCGCGCCTTCCAGCGCCAGCTGGTCCTGACCATGGGTGTGGCCGACTCGCAGCTCTTCTTCTACCCGCAGCTCCTGCCCATCCACACGTTAGACGTCACGAGCACGGCAGTGCCCGCTGCCATTCGCTGCTCCGAGTCGCGCCTTTCGGAGGACGGAGTGTTCCTGCTGGTGAACGGCCTGAACGTGTTCCTGTGGCTGGGCGCCAGCAGCCCGCCCGAGCTCATCCAGGGGATATTCAGCGTGCCGTCGCTGGCACACGTCAGCACAGACATGACGTTACTGCCTGAGGTAGGAAACCCGTATTCTCAAACACTCAGGACAATAATGAGTACCATCCAACAAAAGAGGCCATATTCAATGAAGCTCGTGATCGTAAAGCAGCGAGAACAGGCAGAAATGCTCTTCCGGCAGCTCCTGGTGGAGGACAAGGGACCCCACGGAGGGCCGTCTTACGTGGATTTCCTCTGCTGTGTGCACAAGGAGATCTGTCAGCTGCTGAATTAGCGGAGCCTTCTGTGTTGGCGTTGCGTTTCTAGGGAAATCATCTCCTTCTTGGCGGCTGATTCTCCAGATGACAGCGGGCTCGCTTTGATTCCTTGCTCCTTTTCAGAGTGGCTTTCCACAGCATTCAGACCTTCAGCTTTGGTGCTCAGGTGCGAAGCCAGCGAAGGGACAGCTGTACCTCAAAGGGAACAGTCTGTTTCTATTGTACAATTTTTAACTGTTAAGACTGATGATATACTTTTGCATTTCATGAAAGGCACAGTTTTACAAAACTGTAAACATTCTCAATTTTCCTTCTTTGTGCCAGACATTTAAATTATTTTTCAAAATGTATAGATTTGGGGAAAAGGTTGTCTTGGCTCATCTCCTATTTGCAGTGAGAGGAAAAAAACTTAATTTTTACATTATATCTAATTTTTTTAAACCACGTAACCCCACTGAACATTTTCCACTTGAGGTTTGCATAGCGGACTTTTAATAACCTTGGAATCTATTGGTAGGACCATGTGCGTTCTACATTTTTTTCATAATTCTATGTTGTGTATGTTAAACTATTTTCCGATTGTCTATAAAATTGTCTATCAATACTCTCAAATGGTTCTCTGTACAATAATGAAGGTTTCTACCTGTATATAATGGATCTTAACCAGTATCAATAAATCCCTTCGTATGCTCTACTCAGCAGGGAGGATTCATGTTTCAGGTACTGTGAGGTGACGTCCTCACGGTGCACCCGCACCGAGGTCG