Transcript asmbl_43763

Sequence
Transcript Sequence for observation asmbl_43763 of TGE0005795:
GCTGGAGTCGCCGCGGCTGCCGCGTGACGTGGCACAGCGAAAGGCTTAATACTAGAGCCGGAGCTGCCGCGCCAGTCGTAGAGCAGGTCCGCGCCCCGCTAGTACCTGACCTGGAGCTTAGTCCGAAACGCCGGCTAGCGGGCAGTTCCTGCCGCCGTCTTTCTTCCTTAGCTTCTTTTTCTCGCTCAGTTTGCCGGGAGCTTGGAAGGAGAAGGCCCGGGGACGCTCTGAACCCCTTCTGCTCCTGCCCATCGCAAGTGCCACTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTTGGCAAGAAACAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACAACCATTCTGTATAAGCTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTTACAGTATGGGATGTTGGTGGTCAAGACAAAATAAGGCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTATTTTTGTGGTAGATAGCAATGATCGTGAAAGAATTCAGGAAGGAGCTGACGAACTGCAGAAAATGCTTCAGGAAGATGAATTGCAAGATGCAGTGTTGCTGCTTTTTGCAAACAAACAGGATTTGCCAAATGCTATGGCCATCAGTGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCTACACAAGGAACTGGTCTTTATGAAGGACTTGACTGGCTGTCGAATGAACTTTCAAAACGTTAAATGAAACTGGATATTTAACCAAGGACACGTTTGATAGAATTGGTCTAGGCTTGTTACAACAAAATTAGTTTGCATCTTGGTTATTAAACAGTATCTGGGACTGGTTTGGGCAGAAGATTACAGCGTTTAAACTTATTTTGTTGCCAATTATTGTTTACCAAGTATAATGTTGCCATTTAGCAATATGCTTGGTTTTAAAGAAATTCTCCTTAACTTGGAAAAAAAAGTGTCCTCTTTTAATTTTACTTCCCTTAAGCCTAAATGCCTGGACATAGCTATTGTGACACCTTTAAATAAATCCGTTTTGAATGTTTTTTGAGCCCACAACAATAATGTTTTAAAGTTTTTCCCTTGCTACTTTACTGATACCTTTATCATTCCTGGGACAGTCTGCTGATTTAAAAATGTAGCATTCCATTTGTATTTATTTTTCTCCCTTGCCAAAAAGATTTTTTAATATCGCTTGTACCAGCCAGGAAATGTTCCAAAACACTATTCAGATCTGTTGCACTGAGGAACTTATTTTTTTGCCTGTCATTGACTCCTGGCTTCCATCAGCCAAGCTTACCTTGGTGCGGTTTGGATTTGATAGCTAAATAGTTCTTTGCTGATTGCAAAGAGTTCATATTGAGAAGAGTTTTTAATACCCAGCAGATTGTCTTTCTTTATATTGTATCTTTTTTATGTTGCATGTTGCTTTTGGTATCAGCCTGACTCTTTACCCAGTGTATGATAGTTCTGCTGATGTTTTATTGTTTATTGGTGAACATATCTTCATTAAGAGTTTTTGGAAAACTCATCAGACTCAAATGAATAAGTTTTCTTCATAACCCATTTGAAATTATTCCTAATAAAATGATAAAATATGTAATTGTGTGTGTTCTTTTTTAGTCTTAAAGATGTTTGAAATGGATTTTCTTATTTAGCAAAGTTGATTTGCATATTTTACATACTGTGAACAGTAACACAGATCCCAGTGAATTTACTAATCGTGTAAATTGGAAATAAAATATGGATTGCTATTGTGTGTATATAACAGTGGGGAGCAACTTCAAAAATTTAGTTTTCT