Transcript asmbl_43746

Sequence
Transcript Sequence for observation asmbl_43746 of TGE0005782:
CGCTTCCGGTGCCGCCGTCGCCGTGCGTCCGTGTTGAGTTTCTGTCTTCGCTGAGCCGCTGTAGTCACCGCGGAGATGCCGCTGGAGAACTTGGAGGAGGAGGGTCTGCCCAAGAACCCCGACCTGCGCATCGCGCAGCTGCGCTTCCTGCTCAGCCTACCGGAGCACCGCGGGGACACGGCCGTGCGCGACGAGCTGATGGCGGCCGTCCGCGATAACAACATGGCTCCTTATTATGAAGCCTTGTGCAAATCCCTTGACTGGCAGATGGACATGGACCTGCTCAATAAAATGAAGAAGGCAAATGAAGAAGAGTTGAAACGGTTGGATGAGGAGCTGGAAGATGCAGAGAAAAATCTTGGAGAGAGCGAAATCCGCGATGCAATGATGGCAAAGGCAGAGTACCTCTGCCGGATAGGTGACAAGGAGGGTGCTCTGACAGCCTTTCGCAAGACGTATGACAAAACTGTTGCCCTGGGTCACCGACTGGATATTGTGTTCTATCTCCTTAGGATTGGCTTATTTTATATGGATAATGATCTCATCACACGAAACACAGAAAAGGCCAAAAGCTTAATAGAGGAAGGAGGAGACTGGGACAGAAGAAACCGCCTTAAAGTATATCAAGGTCTTTATTGTGTAGCTATTCGTGATTTCAAACAGGCAGCTGAACTCTTCCTTGACACTGTTTCAACATTTACATCCTATGAGCTCATGGATTATAAAACCTTTGTGACTTATACTGTCTATGTCAGTATGATTGCCTTAGAAAGACCAGATCTCAGGGAAAAGGTTATTAAAGGAGCAGAGATTCTTGAAGTGTTGCACAGTCTTCCAGCAGTTCGGCAGTATTTGTTTTCTCTCTATGAATGTCGTTACTCAGTTTTCTTCCAGTCGTTAGCTGTTGTGGAACAGGAAATGAAAAAGGACTGGCTTTTTGCTCCTCATTATCGGTACTATGTCAGAGAAATGAGAATTCATGCATACAGCCAGCTGCTGGAATCATATAGGTCATTAACCCTGGGCTATATGGCAGAAGCCTTTGGTGTTGGTGTGGAATTCATTGATCAGGAACTCTCCAGATTTATTGCTGCTGGGAGACTACACTGCAAAATAGATAAAGTGAATGAAATAGTGGAAACCAACAGACCTGATAGCAAGAACTGGCAGTACCAAGAAACTATCAAGAAAGGAGATCTGCTGCTAAACAGAGTTCAGAAACTTTCCAGAGTAATTAATATGTAAAACTATGTAAACAAAGGATTTCCTTTAGAGATAATTATTTCGAATTTTTATAGCTTACTCACTATGTGCCCAGTTCACTTGTATAAAATAAATACTGCATCGTTTCTTTCAA