Transcript asmbl_43544

Sequence
Transcript Sequence for observation asmbl_43544 of TGE0005758:
GCCCCCTCCGGAGCCTATAAGTTGCTCGCGGCGCCAGGGCGCCTGCACGTCGGTCCGACTCCGGCCGTGGGTCCGCGGCGCGCGCTTGGCCCCACTCGCTGCCCCCGCAGTCCTGGCCCGGGGCGGACCAGTGGTCCCCGCGCTCTCGCGAGAAGTTCGCCGCCGTAGGGCGGTGGGATGCCAGAGCCCTCACGGGCCCTGGAGGGGCGGAAGATGGGGTGGTGCGCAGAAAAGCCGCAGCTTTTGCTGCTGGCTCTCATCCTCCAGCCCTGGACTCCCTGCCTAGGTGCAGACTCGGAGAAACCCTTCAGCATCCCCACAGATAAATTATTAGTCATAACTGTAGCAACAAAAGAAAGTGATGGATTCCATCGATTTATGCAGTCAGCCCAATACTTCAATTATACTGTGAAGGTCCTTGGTCAAGGAGAAGAGTGGAGAGGTGGTGATGGAATTAATAGTATTGGAGGTGGCCAGAAAGTCAGATTAATGAAAGAAGTTATGGAACATTATGCCAGTCAAGAGGATCTGGTTGTCTTGTTTACTGAATGCTTTGATGTCATATTTGCTGGTGGTCCAGAAGAAGTTCTAAAAAAGTTCCAAAAGTCAAACCATAAAGTGGTCTTTGCAGCTGATGGAATTCTGTGGCCAGATAAAAGACTAGCAGACAAGTATCCCATTGTGCACATTGGGAAACGCTACCTGAATTCGGGAGGATTTATTGGTTATGCTCCATATATCAACCGTATAGTTCAACAGTGGAATCTACAGGATAATGATGACGATCAGCTATTTTATACTAAAATTTACATTGATCCACTGAAAAGGGAAGCTATTAATATCACATTGGATCACAAATGCAAAATTTTCCAGGCCTTAAATGGAGCTGTAGATGAAGTTGTTTTGAAATTTGAAAATGGCAAAGCCAGAGCTAAGAATGTGTTTTATGAAACATTACCAGTGGCAATTAATGGAAATGGACCCACCAAGATTCTTCTGAATTATTTTGGAAACTATGTACCTAATGCATGGACACAGGATAATGGCTGCACTCTTTGTGAATTGGATACAATTGACTTATCTGCAGTAAATGTCTATCCAAATGTAACAATAGGTGTTTTTATTGAACAACCAACCCCTTTCCTATCTCGATTTCTGGATGTATTGTTGACACTGGATTACCCTAAAGAAGCACTTAAAGTCTTTATTCATAACAAAGAAGTTTATCATGAAAAGGACATCAAGGTATTTTTTGATAAAGCTAAACATGAAATCAGTACTATAAAAGTAGTAGGACCAGAAGAAAATCTAAGTCAAGCTGAAGCCAGAAACATGGGAATGGATTTTTGCCGTCAAGATAAGAACTGTGATTACTACTTTAGTGTAGATGCAGATGTGGTTCTGACAAACCCAAGGACTTTAAAAATTTTGATTGAACAAAACAGAAAGATCATTGCCCCTCTTGTAACTCGTCATGGAAAGCTTTGGTCCAACTTCTGGGGAGCATTGAGTCCTGATGGATACTATGCTCGATCAGAAGATTATGTGGATATTGTTCAAGGGAATAGAATAGGGATATGGAATGTCCCGTACATGGCTAATGTCTACTTAATTAAAGGAAAGACGCTCCGATCAGAGATGAATGAAAGGAACTATTTTGTTCGAGATAAACTGGATCCTGATATGGCTCTTTGCCGAAATGCTAGAGAAATGGGTGTATTTATGTACATTTCTAATAGACATGAATTTGGAAGACTATTATCAACTGCTAATTACAATACTTCCCATTATAACAATGACCTCTGGCAGATTTTTGAAAATCCTGTGGACTGGAAGGAAAAGTATATAAACCGCGATTATTCAAAGATTTTCACTGAAAATATAGTTGAACAGCCTTGTCCAGATGTCTTTTGGTTTCCCATATTTTCTGAAAAAGCCTGTGATGAATTGGTGGAAGAAATGGAGCATTATGGCCAGTGGTCTGGAGGCAAACATCATGATAGCCGTATTTCTGGTGGTTATGAAAATGTCCCAACTGATGATATCCACATGAAACAAATTGATCTGGAGAATGTATGGCTTCATTTTATCCGGGAGTTTATTGCACCTGTTACACTGAAGGTCTTTGCAGGCTATTATACAAAGGGGTTTGCATTACTGAATTTTGTGGTAAAATACTCCCCTGATAGACAGCGTTCTCTTCGCCCTCATCACGATGCTTCTACATTTACCATCAACATTGCACTCAATAGTGTGGGAGAAGATTTTCAGGGAGGTGGATGCAAATTCCTAAGGTACAATTGCTCTATTGAATCACCAAGAAAAGGCTGGAGCTTCATGCATCCAGGGAGACTCACACATTTGCATGAAGGACTTCCTGTTAAAAATGGAACACGATACATTGCAGTGTCATTTATAGATCCCTAAGTTATTTACTTTTCATTGAATTGACATTTCTTTGGAATGGATGACTGGTATGAACATATTTTTGAAGTTGTGCTTGAGAAGATGAGAGGAATATTTAAATATTCCACAGAACAACCTAACTTTGGGCCAAACATTTGAAAAACTTTATAAAAAATTGTTTGATATTTCCTAATGTCTGCTCTGAGCCTTAAAACACAGATTGAAGAAGAAAGGAAAAAAGTAAACACAAATATTTATTTCTGTGCCTTATTGTCTTTGAGAATAATGAGAATTTTCTGAATTTGTGTTTCAGTTGATAAAATATTCAGGTACAAATGTACAAGCAACAAATGAGACTGGTAATATTTTATTTAACAAAAGCCTAAGAAGAATTTTATTTATCAACATATAGATGAAGTGAATATAAATGAAAATTGGCAATTTTTAAAATGTCTAAAAACTGGAATTCTAACTGAATTTGTGTGCAACTTATTGTGTAAGTACTTTTTGACCACCTATGCAAGTATGTTTTAAAGTATAGTTCCTGAAGGAATACCAAGAACAATATTACAGTTTTTTTCCTTGAGAAAATTAGTATAAAATGCAATTAGGTGCATACCCAGTTGAAAACATTTTTGTTTAGATTGTTAGACAGACTTTTTTTTACATTTGTATTAGAAATCAAGCCCTGTGTTCCTTCAGATAAATTTTCCAAGGTAGATTATAGTAAATAGATACTAGATTTAGAAAAGCTTTCAAGCCTTTCCATTTCTTATTGACTTAAGATCACCAAGTGACCTTAAGTCAAAAAGGTTGTCGTTCTTTTAATTCTAGAAAATAATGAGGAAATTTTTTTCTTTGAGATTAGTAGTAGCATTTTGATTTTAAAAAATTAAGTACTTGAATTTTATATCAGGAAAATAAAGTTGGTGAGCCTTTCTTCCTTTTTGCCCTTTGTCTCCCTCTTTATGTTCTTTTTTGTGAAGGTTATCCTCTTTTTTGTCTTCCCAGCGTAGTCTCCATTTTATCCTTCTTACTCTTTTTATTACCTTCTCTTTATCACACTTTAGAATAATTTCCTAGCACAAAAAAATTTGTGACTTGATTTTTCACCATTTCTCTGAGTGAGGTTTAAATATCCTTATTGTAGCTACTGTTTTTAATTTAAAGGTTAAACTTGAAAAAAAAGTTCTAAGTCATGGTGCCAAAATTTATTTTTCTAACACTGTGTGTTAGAAAATTATG