Transcript asmbl_43541

Sequence
Transcript Sequence for observation asmbl_43541 of TGE0005759:
GCCCCCTCCGGAGCCTATAAGTTGCTCGCGGCGCCAGGGCGCCTGCACGTCGGTCCGACTCCGGCCGTGGGTCCGCGGCGCGCGCTTGGCCCCACTCGCTGCCCCCGCAGTCCTGGCCCGGGGCGGACCAGTGGTCCCCGCGCTCTCGCGAGAAGTTCGCCGCCGTAGGGCGGTGGGATGCCAGAGCCCTCACGGGCCCTGGAGGGGCGGAAGATGGGGTGGTGCGCAGAAAAGCCGCAGCTTTTGCTGCTGGCTCTCATCCTCCAGCCCTGGACTCCCTGCCTAGGTGCAGACTCGGAGAAACCCTTCAGCATCCCCACAGATAAATTATTAGTCATAACTGTAGCAACAAAAGAAAGTGATGGATTCCATCGATTTATGCAGTCAGCCCAATACTTCAATTATACTGTGAAGGTCCTTGGTCAAGGAGAAGAGTGGAGAGGTGGTGATGGAATTAATAGTATTGGAGGTGGCCAGAAAGTCAGATTAATGAAAGAAGTTATGGAACATTATGCCAGTCAAGAGGATCTGGTTGTCTTGTTTACTGAATGCTTTGATGTCATATTTGCTGGTGGTCCAGAAGAAGTTCTAAAAAAGTTCCAAAAGTCAAACCATAAAGTGGTCTTTGCAGCTGATGGAATTCTGTGGCCAGATAAAAGACTAGCAGACAAGTATCCCATTGTGCACATTGGGAAACGCTACCTGAATTCGGGAGGATTTATTGGTTATGCTCCATATATCAACCGTATAGTTCAACAGTGGAATCTACAGGATAATGATGACGATCAGCTATTTTATACTAAAATTTACATTGATCCACTGAAAAGGGAAGCTATTAATATCACATTGGATCACAAATGCAAAATTTTCCAGGCCTTAAATGGAGCTGTAGATGAAGTTGTTTTGAAATTTGAAAATGGCAAAGCCAGAGCTAAGAATGTGTTTTATGAAACATTACCAGTGGCAATTAATGGAAATGGACCCACCAAGATTCTTCTGAATTATTTTGGAAACTATGTACCTAATGCATGGACACAGGATAATGGCTGCACTCTTTGTGAATTGGATACAATTGACTTATCTGCAGTAAATGTCTATCCAAATGTAACAATAGGTGTTTTTATTGAACAACCAACCCCTTTCCTATCTCGATTTCTGGATGTATTGTTGACACTGGATTACCCTAAAGAAGCACTTAAAGTCTTTATTCATAACAAAGAAGTTTATCATGAAAAGGACATCAAGGTATTTTTTGATAAAGCTAAACATGAAATCAGTACTATAAAAGTAGTAGGACCAGAAGAAAATCTAAGTCAAGCTGAAGCCAGAAACATGGGAATGGATTTTTGCCGTCAAGATAAGAACTGTGATTACTACTTTAGTGTAGATGCAGATGTGGTTCTGACAAACCCAAGGACTTTAAAAATTTTGATTGAACAAAACAGAAAGATCATTGCCCCTCTTGTAACTCGTCATGGAAAGCTTTGGTCCAACTTCTGGGGAGCATTGAGTCCTGATGGATACTATGCTCGATCAGAAGATTATGTGGATATTGTTCAAGGGAATAGAATAGGGATATGGAATGTCCCGTACATGGCTAATGTCTACTTAATTAAAGGAAAGACGCTCCGATCAGAGATGAATGAAAGGAACTATTTTGTTCGAGATAAACTGGATCCTGATATGGCTCTTTGCCGAAATGCTAGAGAAATGACATTACAAAGGGAAAAAGACTCCCCTACTCCGGAAACATTCCAAATGCTCAGCCCCCCAAAGGGTGTATTTATGTACATTTCTAATAGACATGAATTTGGAAGACTATTATCAACTGCTAATTACAATACTTCCCATTATAACAATGACCTCTGGCAGATTTTTGAAAATCCTGTGGACTGGAAGGAAAAGTATATAAACCGCGATTATTCAAAGATTTTCACTGAAAATATAGTTGAACAGCCTTGTCCAGATGTCTTTTGGTTTCCCATATTTTCTGAAAAAGCCTGTGATGAATTGGTGGAAGAAATGGAGCATTATGGCCAGTGGTCTGGAGGCAAACATCATGATAGCCGTATTTCTGGTGGTTATGAAAATGTCCCAACTGATGATATCCACATGAAACAAATTGATCTGGAGAATGTATGGCTTCATTTTATCCGGGAGTTTATTGCACCTGTTACACTGAAGGTCTTTGCAGGCTATTATACAAAGGGGTTTGCATTACTGAATTTTGTGGTAAAATACTCCCCTGATAGACAGCGTTCTCTTCGCCCTCATCACGATGCTTCTACATTTACCATCAACATTGCACTCAATAGTGTGGGAGAAGATTTTCAGGGAGGTGGATGCAAATTCCTAAGGTACAATTGCTCTATTGAATCACCAAGAAAAGGCTGGAGCTTCATGCATCCAGGGAGACTCACACATTTGCATGAAGGACTTCCTGTTAAAAATGGAACACGATACATTGCAGTGTCATTTATAGATCCCTAAGTTATTTACTTTTCATTGAATTGACATTTCTTTGGAATGGATGACTGGTATGAACATATTTTTGAAGTTGTGCTTGAGAAGATGAGAGGAATATTTAAATATTCCACAGAACAACCTAACTTTGGGCCAAACATTTGAAAAACTTTATAAAAAATTGTTTGATATTTCCTAATGTCTGCTCTGAGCCTTAAAACACAGATTGAAGAAGAAAGGAAAAAAGTAAACACAAATATTTATTTCTGTGCCTTATTGTCTTTGAGAATAATGAGAATTTTCTGAATTTGTGTTTCAGTTGATAAAATATTCAGGTACAAATGTACAAGCAACAAATGAGACTGGTAATATTTTATTTAACAAAAGCCTAAGAAGAATTTTATTTATCAACATATAGATGAAGTGAATATAAATGAAAATTGGCAATTTTTAAAATGTCTAAAAACTGGAATTCTAACTGAATTTGTGTGCAACTTATTGTGTAAGTACTTTTTGACCACCTATGCAAGTATGTTTTAAAGTATAGTTCCTGAAGGAATACCAAGAACAATATTACAGTTTTTTTCCTTGAGAAAATTAGTATAAAATGCAATTAGGTGCATACCCAGTTGAAAACATTTTTGTTTAGATTGTTAGACAGACTTTTTTTTACATTTGTATTAGAAATCAAGCCCTGTGTTCCTTCAGATAAATTTTCCAAGGTAGATTATAGTAAATAGATACTAGATTTAGAAAAGCTTTCAAGCCTTTCCATTTCTTATTGACTTAAGATCACCAAGTGACCTTAAGTCAAAAAGGTTGTCGTTCTTTTAATTCTAGAAAATAATGAGGAAATTTTTTTCTTTGAGATTAGTAGTAGCATTTTGATTTTAAAAAATTAAGTACTTGAATTTTATATCAGGAAAATAAAGTTGGTGAGCCTTTCTTCCTTTTTGCCCTTTGTCTCCCTCTTTATGTTCTTTTTTGTGAAGGTTATCCTCTTTTTTGTCTTCCCAGCGTAGTCTCCATTTTATCCTTCTTACTCTTTTTATTACCTTCTCTTTATCACACTTTAGAATAATTTCCTAGCACAAAAAAATTTGTGACTTGATTTTTCACCATTTCTCTGAGTGAGGTTTAAATATCCTTATTGTAGCTACTGTTTTTAATTTAAAGGTTAAACTTGAAAAAAAAGTTCTAAGTCATGGTGCCAAAATTTATTTTTCTAACACTGTGTGTTAGAAAATTATG