Transcript asmbl_42327

Sequence
Transcript Sequence for observation asmbl_42327 of TGE0005674:
GGGCTGGGAAGGCGGGTACCCCGAAATCGTCAAAGAGAACAAGCTCTTCGAGCACTACTACCAGGAGCTGAAGATCGTGCCGGAGGGCGAGTGGGACCAGTTCATGGAAGCGCTCAGGGAGCCCCTCCCGGCCACCTTAAGAATTACTGGTTACAAAAGCCACGCGAAAGAGATTCTCCATTGCTTAAAGAACAAGTATTTCAAGGAATTGGAAGACCTGGAGGTGGACGGTCAGAAAGTTGAAGTTCCACAACCCCTGAGTTGGTATCCTGAAGAACTTGCCTGGCACACAAATTTAAGTCGAAAAATCTTGCGAAAGTCTCCACAATTGGAAAAGTTTCACCAGTTTCTGGTTAGCGAAACCGAATCTGGAAACATCAGTCGTCAAGAAGCCGTTAGCATGATTCCACCGCTGTTGCTTAATGCTCATCCTCACCACAAGATCTTAGATATGTGTGCAGCGCCTGGATCGAAGACCACGCAGTTAATCGAAATGCTGCATGCCGACATGAGCGTCCCTTTCCCAGAGGGATTTGTCATCGCGAATGACGTGGACAACAAACGCTGCTATCTGCTCGTCCATCAGGCCAAAAGGCTGAGCAGCCCGTGCATCATGGTGGTCAACCACGACGCGGCCAGCATCCCGAGACTCAGCGTGGACGTGGGCGGGAGGAAGGAGATTCTCTTCTACGATCGCATCTTATGCGACGTCCCCTGCAGTGGAGATGGCACTATGAGAAAAAACATCGATGTTTGGAAAAAGTGGACCACGTTAAACAGCTTGCAGCTGCACGGCTTACAGCTACGCATCGCCACGCGGGGGGCTGAGCAGCTGGTAGAAGGCGGTCGGATGGTTTACTCCACGTGTTCCCTGAACCCTATCGAAGATGAAGCAGTCATAGCATCTTTACTGGAAAAAAGCGAAGGTGCCTTGGAGCTTGCTGACGTGTCTTCTGAGTTGCCGGGACTAAAGTGGATGCCTGGACTCACCCAGTGGAAGGTCATGACAAAAGATGGACAGTGGTTCGCATCGTGGGACGAGGTTCCTCACAGCAGACACACCCAGATCCGTCCCACCATGTTCCCACCGAAGGACGCGAACACGCTGCAGGCCATGCACCTAGAGCGGTGTCTTAGAATATTACCACATCATCAAAATACTGGCGGGTTCTTCGTGGCAGTATTAGTGAAAAAGTCTTCGATGCCATGGAATAAGCGTGCACCAAAGCTGCAGGGAGACTCTGCGGAGCTGAGGGCGCCTGCGCAGTCCAGCCCTGCAGGTCCCACGGGAGGGACAGCTGCGGGTCCCTCCGAGCTGGAAAGGACACCAGTCACTGGAATGGGTGACGCGGAAGTAATTGAAAGAACTGAGAACTTAGACGATAACGGAAACAAGAAAGACGGCGTGTGTGGTCCTCCTCCATCGAAGAAAATGAAGCTGTTTGGATTTAAAGAGGATCCGTTCGTGTTTATTCCTGAAGATGACCCATTATTTCCACCTATCCAGAAATTTTACGCTCTGGACCCTTCGTTCCCGAGGATGAATTTGTTGACGCGAACGACGGAAGGGAAGAAAAGGCAGCTCTACATGGTCTCCAAGGAGCTGCGGAACGTGCTGCTGAACAACAGCGAGCGGGTGAAGGTTATCAACACCGGGATAAAAGTCTGGTGTCGAAACAACAGTGGAGAAGAGTTCGATTGTGCTTTCCGGCTGGCACAGGAGGGAATATATACACTGTATCCATTTATTAACTCAAGAATCATTACTGTGTCGTTGGAAGACGTTAAAATCCTATTAACCCAGGAAAATCCATTTTTTAGAAAACTTAGCAGTGAGACGTACAGCCAAGCCAAGGACCTGGCCAAGGGGAGTGTCGTCCTGAAGTACGAGCCAGACCCCACGAAACCAGACACCCTGCAGTGTCCCATCGTGTTGTGTGGATGGCGGGGAAAGGCCTCAATTCGAACTTTCGTGCCCAAGAATGAGCGGCTGCATTACCTCAGGATGATGGGGCTGGAGGTGCTGGCAGAGAAGAAGAAGGAAGGGCCTGTCCTGACAGGCGACAGTGCCTCTGGCTCCGGGCCACCGGAGGACGAGGCGAGTGCCGACCGGGACGAAGAGCAGGCTGCCAGTGTGGACGGCGCAGGCGGTGACCCGGCCGGGGGTCCTGGGGCGTCTGCACCCCAGTCCAGAACTGCTGACCTGTAAAGCACGATTTTAACGGCTGGAAACAGACGGGATGGTAGAAGCTTCTGCGAGTGACCGCCGTCCTGCTGTCGCACGGCGTGTGAGGAAAGTATGTTTTCAGCTTGTTCGTTGCTCCTTTTACTTTGTTCTCTGGCGAAGCTGGGCCCAGCGCCTGCTGCCGGTGGGAGGCTTCGTGGTCGAGGTCTCGCTTCCATCAAGAAATGTCACTGCCCACGCAGAAACGTTCAGGTCCCTTCATTACACCTGCATTGGTCTTAAAGTCCAGTATTTCTTTTAATTATTATTTATAGGGAGGATCTGTATGTCCTTACGAGTCGTTGGAAACCATGCTGTAAGCTTTAATAATTGTATTAAGTTGCGTATCAGTGCGACATCGGTGCACAGTGGGTTAATATCCGGGCTGTCAGACGGCTTCTGTGCCTTTATAACAAAGAGTGAAATGTATCCTGTCATGTCAGAGAGACCTGCGTCATGAACTGTGAGGCTCATGAGGGTTTTATGTGCTTTTAGGAAACGAAGCACTTTGCAGTTTTAATTTTTTAATGGGGTTTGGGATGCCTGGAACGTTTAATTAAAGAGACTAATGAAATGTG