Transcript asmbl_41904

Sequence
Transcript Sequence for observation asmbl_41904 of TGE0005644:
TCCCTTTCCAACAAGTACGGAAGGAACTTCCATAAAGTCATTTCCGGGAAGCGGGGTCGCGCTTTGTTCGCTGCAACATGGAGGCGAGTGGCGGAGCCGATGAGGCGGTTTCCGGGGAATTGGTGTCGGTGGCTCACGCTCTTTCTCTCCCCGCCGAGTCTTATGGCAACGATCCTGATATCGAGATGGCTTGGGCCATGAGAGCAATGCAGCACGCCGAAGTCTACTACAAGCTGATTTCATCAGTTGACCCACAGTTCCTGAAACTTACCAAAGTGGATGACCAAATCTATTCTGAATTTCGGAAAAATTTTGAGAATCTCAAGATAGATGTATTGGACCCAGAAGAGCTCAAATCGGTATCAGCTAAAGAGAAGTGGAGGCCATTCTGTTTGCAGTTTGATGGGGTTATAGAAGACTTCAACTATGGTACTTTGCTGCGACTGGATTGTTCTCAGGGCTACACTGAGGAAAACACAATCTTTGCCCCCAGGATACAATTTTTTGCCATTGAAATTGCTCGGAACAGGGAAGGCTATAACAAAGCAGTTTACGACAGTGTTCAGGACAAAGAAGACAAAGGGGCCAACAATGGCGAAAAAGAGAAAAGCGACAAAGGAGAAGAGAAAGAGAAAAAAGCCAAGAATGGAGTCAATGAAAGCGACGAAATAGCTATGTAAGGTAGACAGGGGACAGCACTCTAGAAACTGTGACTCGGCGGAGTCTACAAGTACCATGATGTTACTTGCACAGAACCCTACGGTTAAAGGTACGCCCTGTGCAGTCGAAGGCCATCTTTCTAGCCTAATAATCAGGAGCTGTTCTGATTGTTCTCTTGTAGGAATTGGCTTAAAGGCTATTAGTGGAGTCATAGTGGATTGTTTCTTGTTATATTTTTTCTTGTTATTTTTTTTCCACCAGTTACGTAAGAAATTTTGTAAATAAATTTCTTTTGGTTCTTATGACTGTCTATATCCGTGATTGACTTTGTTAAAGATATTCAAAATTA