Transcript asmbl_41519

Sequence
Transcript Sequence for observation asmbl_41519 of TGE0005616:
AGGTGTAAAGATTTCTCTCTGTGTTACTGGAATCCCTATTGGATGCTGCCCTCTGATGTTTGTGGAATGAACTGCTTTTGGGAAGCGGCTTTTAGGTATAGTCTGAAAATACAGCCTGTACAGAGAATACACCTGGCTGTCGTTGCCTGTGGTGAAAGACTGGAAGAAACTATCACCATGCTCAAGTCAGCTATCATTTTCAGCATCAAACCTCTTCAATTCCATATTTTTGCCGAAGATCAACTACACGATAGTTTTAGAGGCATCCTCGACAACTGGTCATTTCTACAAACATTTAACTATTCATTATACCCAATAATTTTTCCAAGTGAGAATGCTGCGGAGTGGAAAAAGCTCTTTAAACCATGCGCTTCCCAGAGATTGTTCTTGCCATTAATCCTGAAGGAAGTTGACTCACTATTGTATGTCGACACTGATATCCTTTTTTTGCGGCCCGTTGATGATATTTGGTCTTTACTAAAGAAATTTAATTCCACACAAATTGCTGCAATGGCACCAGAACATGAAGAGCCTCGGATAGGATGGTATAATCGCTTTGCCAGACATCCATACTATGGCAAAACTGGAGTAAACTCTGGAGTTATGTTGATGAACATGACTAGAATAAGACGGAAGTATTTCAAGAATGATATGACAACTGCACGACTACGATGGGGAGATATACTTATGCCATTGCTCAAAAAATACAAACTAAATATCACATGGGGTGATCAAGATCTGTTGAATATCATATTTTTTCATAATCCAGAAAGCCTTTTTGTTTTTCCCTGTCAATGGAATTATCGACCAGATCATTGTATATATGGAAGCAATTGCCAAGAAGCAGAAGAAGAAGGAATCTTTATTCTTCATGGGAACAGAGGTGTTTACCATGATGATAAGCAACCAGCATTTAGAGCTATTTATGAAGCACTAAGAAATTGTTCTTTTGAAGATGACAACATCCGTTCCTTGTTAAAGCCTTTAGAACTGGAACTGCAAAAGACAGTACATACATACTGTGGAAAAATTTACAAGATATTTATCAAACAGCTAACAAAAAGCATACGAGACCGTTATGATAGACCACCAAAGGAAAGGTGATTCTTGGTGACCACCGAATCAAGTGAATTAAAACAACAAAATATTAGAAGATATATGTGAAGGAATAGTCTTGAACGAAGTGTACGAGAAGGAATTATTCATCTTCAGAATAATTTTTTTCCTGAAGAAATTAAGTGAGCAATATATTCATATAATGAAGAATAAATTAAAGTCTTGGACCCCAACAAAAAGACATTTTTCATCTCTGATGTGTTGTAATGTTATTTGCTATCCTTCCAGTGTTGATGAATATATTGAATTGTGTAGCCTACAGACTTTGGTTGACTTATTTTCAAGAGAGTAAGAACAGTAGGGGTGTATGGATGGAGAGAATGTACCTCATACACAGTGGAAACAAACTGTGAGTATAGCAATAATTTTATGTCAGCACTAACCTCACTTTAAATGTGTGAGAAAAAAGTTGTTTACAGGAGCAGAAAAAATTCTGTTTCTAAAGAAATGTGATGTAACCATCGACAATCTTCATGTGCCTTTATAGATTTCATCTCGTTTTAAAATCGTTCCTTGTGACAATCATGTTTAAATTTATTTTTAGATTGTAAGTAAGTAAGCTGCACGTTTAAAATTGAGCTGTATAAGAAAGAAGGAAGACTGAAAATTTTGGAGTTTTAGTCTCTGTGTTTATGAAACGTGGCGTTTTCATTTGTCTTGCCAAACTTAGATCTAAGATTGTTAAACAGATCCTTTGGGAAACATTTTTTTTATCACTTTAAATGAAAATTTTCAGCTTTACTGGGCATTCTGGAAATAAAAAATATGCTGATAATAAAGTGAGAACCTACATGGTATTACATGATGGTGGAAAATGTGATGGACCAAAATACATAAGCTATATACTTCCGGTGAACAGTAATTTTAGTTTTAGTGGAGCAGAAAATGAATGATCTATTTAAACTTCTTTTCTTCTACCTCAAAATGGCGTAGCAAGGTATTTTTGAAGAAGCAACTATATAGAGCCTTACTTTAAATAAGTCAGATAACTTTCATGAATGATTCAGATTAAGAAAATTGTTACCTCTGACTATACAAAAAGTAGTTTTGATTGGGTTAATGTGGTATCTTTCTTTTTTGAATATTACTTAAGACTTTTTTTAATGTTGAAAATATGAGAAATATTACTTCTCGTAGTGTTCTTGACAGCTATCTAATTAATATAACGATGGATTCTGAGTACTTAACACGTGCTATGGCACATACCTCATTTTACCAAGTGCTATATGGTTATATTCTTTTTCTCTTTTTGATATTTTAATGCTTAAATAGAGAAATGGAAATCATGAAGGAAAAATATCACTTCTATGAAAATAGTGATGATTGGTTTCATGAGGACACAGTGCTCTGTGCAGACATAGAACATACAGAAAGATGATCAGTACCGTTGTCTCCTATCTTTTGTAGTTCAGTCAAGGACACATTGAGAGAAGGTGTAAGGAAGGCAGATTAGTTGATAACTAGCCTAGCTCTCTTAGATGCATTTAGAGAGCACAGTCTGTACATCCTTGACAGAATTACCATGGTGAATATAATAGTTTATGAACTGTGTTGAAGTTGAGTTTGCTAAGTAGAAAATGAGAATCCTAGAATTTTCAAGTTTGGAGGGTATGTAGAAGATTGTTTCTAACAGTCCCCAAATAAGACAATTGCTTGCCTGGCTGTATCAGACTCTCGGGGAGCTTGTTGAGAATGGATTTCTGGGTCCACTGTGTGTAGGATGGGGTC