Transcript asmbl_40916

Sequence
Transcript Sequence for observation asmbl_40916 of TGE0005590:
CCTCCTCCCTGAGCTAACTGTGTGCGCCCCAGCCGCGCGCAGCTACTCGCGTCCGAGCCTCGCGCAAGCTCTCGTGTGTGCCGTGTCGTTTGGCGTCCACCTACCCCTCCGCTCTCCTTGCAAGTACCCCGCGCGTCTGCCACGCAGTCATGTCGTCCGGCAGCCGCGTTGCGCTGGTGACCGGCGCCAACAAGGGCATCGGCCTTGCCATTGTGCGCGACCTGTGCCGGCAGTTCTCCGGGGACGTGGTGCTCACAGCGCGGGACGCGGCGCGGGGCCAGGCAGCCGTGCAGCAGCTGCAGGCCGAGGGCCTGAGCCCGCGCTTCCACCAGCTGGACATCGACGACCTGCAGAGCATCCGCGCCCTGCGCGACTTTCTGCGCAAGGAGTACGGGGGCCTGGACGTGCTGGTCAACAACGCCGGCATCGCCTTCAAGTTAAAGGATCCCACACCGTTTCATATACAAGCAGAAGTGACAATGAAAACAAACTTTTTTGGTACCCGAGATGTCTCCACGGAACTACTGCCTCTCATGAAACCCCAAGGCAGAGTGGTGAATGTGTCCAGCAGCGTAAGCCTCACTGCTCTCAGGAGCTGCAGCCCAGAGCTGCAGCAGCAGTTTAGAAGCGAGACCATCAGTGAGGAGGAGCTGGTGGGGCTCATGAACAAGTTCGTGGAAGATGCGAAGAACGGTGTGCACCAGGAGGCGGGCTGGCCTACTAACGCCTACGGAGTGACGAAAATCGGTGTCACGGTCCTGTCCAGAATCCAGGCCAGGAACCTGAGCACGCAGAGGAAAGGGGACAAGATCCTCCTGAATGCCTGCTGTCCAGGGTGGGTGAGAACTGACATGGCGGGATCCAGAGCCCCCAAAAGCCCGGAGGAAGGCGCAGAAACCCCCGTGTACTTGGCCCTTTTGCCCTCGGATGCTACAGAGCCTCATGGGCAGTTTGTTAAGGAGAAAAAAGTTGAACAGTGGTGAGTGAGCTCAACCCATAGAGCTCCATCCATAGTTTCCATGTTGTACCCGTCCTGATTTGATCCAAAGTGTGTTTAACACAGTCAAAACTATCCCTACCAAGGATTCACTTTGAATTGTCTACCAATTCTATGAAGCCTTTTGTAATTTGTGATGTTTATGCAGTTCTCTGTGATATTCTATAGGGAGAACACATGTGTTAGTGCTGATAATAACGAATTAAAATCAATAGAGGAATAAATGGTCCTTTTGTTTTCTGTAGATTGAAAAGATGTGTAGGTATAGTTTTG