Transcript asmbl_40828

Sequence
Transcript Sequence for observation asmbl_40828 of TGE0005584:
GGGACACGAACGGAGATAGTGTACGGGATTGTTCTCTCTGCGGGGCCTCAAGGGAAAAGGAATAGCTATGTCATCCTTGATCAAAAAGGTGATCAGCACCGTGAAAGCCCCAGGGGCCATTGGTCCCTACAGTCAAGCTGTGTTAGTCGACAGGACCATTTACATTTCAGGACAGATAGGCATGGACCCTTCAAGTGGACAACTTGTGCCAGGAGGTGTGGTAGAAGAAGCTAAACAAGCTCTTACAAACATGGGTGAAATTCTGAAAGCTGCAGGCTGTGACTTCACTAATGTGGTAAAAACAACTGTTTTGCTGGCTGACATAAATGACTTTGGTACTGTCAATGAAATCTATAAACAGTATTTCAAAAGTGATTTTCCTGCAAGAGCTGCTTACCAGGTTGCTGCTTTGCCCAAAGGAGGCCGTGTTGAGATTGAAGCAGTAGCTATCCAAGGCCCTCTCACAACAGCATCACTCTAAGCAGGCCTAATAATATTTAGTCTGGAATATTAATAATGTTTTAAAATATATTAATTTTTATAATCAATGTTGGAAAGTATAAGACAGACTAAAATATCTGAAGTATAAAGAAAATACCATATAATAAGGGGACTTGAACATGAATTACAGATGAAATGATGAATCCACTCACTGATGTTATAAAGAACAGTTATGCATGCCCACATGCCTGGATGCGAGAGGAGACACATTGCGTTACGTAGTCACTCAAACAAATAAAAGGAAATAACACTCAGGAAATATGAGTTACTATTCCTGAGAAATAGTGAAGAGTACATGTATTAGTTAAATACTAATAATTTGATGGTGTGAAATATTTAGTTCTCATGTCAAATATGTGATTCTGCTTTTACTTGAGTAAAATTAAAGATTTAAGTTTGAATGGTAGACGTAAAGGCAAAAAAAAGTGGACCAAAATTGTATATAGCTAATATTTTTCTAATGGAAATAAATTAGACTTGCAGATTT