Transcript asmbl_39726

Sequence
Transcript Sequence for observation asmbl_39726 of TGE0005521:
GGGTGCTAGAATCTGGGGCTCAACGTTGGTCTCTTGGGAATGTGGAGAGCTGGCAGCATGTCGGCGGAGCTGGGAGTCGCGTTCGCTCTGCTGGCAGTGAACGAGCGCGTGCAGCAGGCGGTGGCACGGCGGCCGCGGGATCTCCCGGCCATCCAGCCCCGGCTAGTAGCCGTCAGCAAAACCAAACCTGCAGACATGGTGATTGAGGCCTATAGTCATGGCCAGCGCTCTTTTGGGGAGAACTATGTTCAAGAACTGCTAGAAAAAGCATCAAATCCTAAAATTCTGTCTTCATGTCCTGAGATCAAATGGCACTTCATTGGCCACCTGCAGAAACAAAATGTCAACAAATTGATGGCTGTCCCCAATCTCTTCATGCTGGAAACAGTGGATTCTATGAAGTTGGCAGACAAAGTCAACAGTTCATGGCAGAAAAAAGGTTCCTCTGAAAGGTTAAAGGTTATGGTCCAAATTAACACCAGTGGAGAAGAGAGTAAACATGGCCTTCTACCTTCAGAGACAGTAGCCATGGTGGAACACATAAATACCAAGTGCCCCAGCCTGGAATTTGTGGGGCTGATGACCATAGGAAGCTTTGGGCATGATCTTAGTCAAGGACCAAATCCAGACTTCCAGATGTTATTGTCTCTCCGGGAAGAGCTATGTAAAAAACTGAACATCACTGCTGACCAGGTTGAGCTGAGCATGGGCATGTCCATGGACTTCCAGCATGCAATTGAAGTAGGATCTACGAATGTCCGCATTGGAAGCACCATTTTTGGAGAGCGAGATTACTCAAAGAAGCCTGCCCTGGACAAGTCCGCAGCAGACCTGAAGGCCCCCATAGAAGTAACACAGGCACACTGAGCCAAGGAACAGCCAGCAGTGGCTCACAGCCTGTGGCCCTGTCCAGGAAGACTAACTATGCACCCATCTGGATTTTCATTTTGATATTCCCTAAGTTACAGCACAACCATGCTCTCTTTGTGACCTGGAGAGAGTGTGCTGAGGATTTTGTGTGCTGATGGAAATCTTCTGTATTTAGTGTCTGACATAGGGAGCTCGCTTCAAGTAATGGCCTTTGGATTGGATTTGAGAAATCCAGACATTTCTGCAGATATAAAATCAATAGGCAGGAATTGAGTTCAATATTAAATCCTGCCTGGGAGCACCAACTGACACATCAATGCCTTTCCCAGGTTAATATTTGGTCACTGGTGCCTATAATCTCCAAAGTCAGAGGGATTCCCATTTGTCGTTCACTTTAATAGAAAATTCCCTGTGGTTACAGACTCCATACAAACCCCTACTGAGTAATCATCTCTGCTGCCCTGGAGGAAGGTGATTTCTTCCCCGCCCCGTAAACCCCCACCTCCCTCCCACCCCACCCCCACACCCCACTGCNNNNNNN