Transcript asmbl_39687

Sequence
Transcript Sequence for observation asmbl_39687 of TGE0016110:
GACAGAGGGGCCATCCCTCAGGCTTCTCCCGCTTCACGTCAACCCCTGCCCTGGCCACCTGCGCTCCGGGCCCAGCTGCGCACGCGCGCATCCAGAGCCAGACAGTTGGTGGTGTTGGTACGCCCCAGCTGTTCCTCTCCGCACGCAACCCCGCGTCGCGCGACCCCGGTGTGACACCACGGCGCAAACGCGGCGCGGGGGGAGGCAGGGGCGCGCAGGCGCCGCGGGGGGAGTGAGGCCGCGCAGGCGCGGACGGCGTTGGTTGAAGAAGACCTTCAGCGTTGCCCTGGCGGAGCGGAGACCGGCTCTCTCTGGGTGGAGATATGTGTAACACACCGACTTACTGTGACCTAGGAAAGGCTGCCAAGGATGTCTTCAACAAAGGATATGGGTTTGGCATGGTAAAAATAGATCTGAGAACCAAGTCATGTAGTGGAGTGGAATTTTCTACTTCTGGTCATGCGTACACTGATACAGGGAAAGCGTCAGGCAACCTAGAGACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAAAAATGGAACACAGACAATACTCTTGGAACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATCTTTGTACCGAACACAGGGAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTCAGTCTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTGTTAGCCCTTGAAGGTTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAATCTAAACTGTCACAGAATAATTTCGCCCTGGGTTATAAGGCTGCAGATTTCCAGCTGCACACTCACGTGAATGATGGCACTGAATTTGGAGGGTCTATCTACCAGAAGGTTAATGAGAAGATTGAAACGTCAATAAACCTCGCTTGGACAGCTGGCAGTAACAATACCTGTATTGGCATCGCTGCTAAATACAAGCTGGATTGTAGAACTTCTTTATCTGTACTGTGCTAAGGGCTTTACGTGTATTTTCTCATTTAATCCTCACAACTACTATAGGTGGCCAAAGTAAATAATGCCAGCCTGATTGGACTTGGTTATACTCAGACCCTTCGACCAGGAGTCAAACTGACCCTGTCAGCTTTAGTCGATGGAAAGAACTTCAATGCAGGAGGTCACAAGGTTGGGTTGGGATTCGAACTAGAAGCTTAATGTGGTTTTGAATAAAGCATCAAATTTGTTCCTGGAGGTGAAGAGAAATGAATCCACTATGTTTTGGCCTTAAAATTCTTCTCTGAAATTTCAAAAGTGTGAACTTTTTATTCTTCCAAAGAATTGTAATCCTCCCCACGCTGAAGTCTAGAGATCGCAAGTCCACCCTAAGGGAGGTCCTTAAAGGCATGCCTGGAAGTTGTTATGTTTGTGCCACATTTCAGTTCCGCAGTATTATTTTAAATGTGTTCCTCGGCGACAATGTAGTGTCATGTTAAAGGAAATGACTCGATCCTCCAGTTTGTACATCACGTCCTGCATGTCCCACACCACTTTTTCATGACCGTTTAATATATTGGTCTGTGTGCTGTAGTGGAATCTTTGGTTTTGCATCAGGGTATAATAAAATAAACCCATCACATTTGAACATAA