Transcript asmbl_39633

Sequence
Transcript Sequence for observation asmbl_39633 of TGE0005501:
GGGCCTTCTGCGGCTGCCGTAGCCCCAGACGGTAAACAGGAAATGGGACTCTATCTGGGACTCAATATTCGGGTGAAAAAGACCCGGGATTCAGTTGAGACGTCTACTGCTGCTTTTGCGTACACTTTCAGGGTGTACCGTCCTCCATCTCCACTGTTTGCCTCTCTCTCCTGTTCCTGTTCCAATCAAGGTATTTTGTCTTGAGCCACCTCCCACCTCTTTATCGAGAAGTGTCACCAGAACCATGGCTGAATACTCCTATGTGAAGTCCACCAAACTCGTGCTCAAAGGAACCAAAGCTAAGAGTAAGAAGAAAAAGAGCAAAGAGAAGAAGAGAAAAAGAGAAGATGATGAAGAAACCCAACTTGATATTGTTGGAATTTGGTGGACAGTAACAAACTTCGGTGAAATTTCAGGAACCATAGCAATTGAAATGGATAAAGGAACCTACATACATGCCCTTGACAATGGACTTTTTACACTGGGAGCTCCACATAAAGAAGTTGATGAAGGCCCTAGTCCTCCAGAGCAGTTTACAGCTGTCAAATTGTCTGATTCTAGAATTGCCCTGAAATCTGGCTATGGAAAATACCTTGGTATAAATTCAGATGGACTTGTTGTTGGGCGTTCAGATGCAATTGGACCAAGAGAACAATGGGAACCGGTCTTTCAAGATGGGAAAATGGCTTTATTGGCCTCAAATAGTTGCTTTATTAGATGCAATGAAGCAGGTGATATAGAAGCAAAAAGTAAAACAGCAGGAGAAGAAGAAATGATAAAGATTAGATCCTGTGCTGAAAGAGAAACTAAGAAAAAAGATGATATTCCTGAAGAAGACAAAGGAAATGTTAAACAGTGTGAAATCAATTATGTGAAGAAATTTCAAAGCTTCCAAGACCACAAACTTAAAATAAGTAAAGAAGACAGTAAAATTCTTAAAAAGGCCCGGAAAGATGGATTTTTGCATGAAACACTTCTGGATAGGAGAGCCAAATTGAAAGCTGATAGATACTGCAAATGACCAGGATTTTTATGGGTTTTTTTCTTTCTTTCTTTC