Transcript asmbl_14459

Sequence
Transcript Sequence for observation asmbl_14459 of TGE0000296:
CGAGAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGATCTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAACCTGCCCTGGGTTGAAAAATACCGGCCACAGACCCTGAATGATCTCATTTCTCATCAGGACATTCTGAGTACCATTCAGAAGTTTATCAATGAAGACCGACTGCCACACTTGCTTCTCTACGGTCCCCCAGGGACAGGCAAGACATCTACCATCCTAGCCTGTGCGAAACAGCTATATAAAGACAAAGAATTTGGCTCCATGGTCTTGGAGCTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAAGAAAGGCTTTAAGCTAGTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAGAATGCCTTGAGAAGAGTAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATCATCCCTGCCTTGCAGTCCCGCTGCACGAGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAAAGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAGAGCACCAATATGGCCTTTGGGAAGGTGACAGAGGAGACTGTCTACACCTGCACCGGGCACCCGCTCAAGTCAGACATTGCCAACATCCTGGACTGGATGTTGAATCAAGATTTCACCACAGCCTACAGAAATATTACAGAGTTGAAAACTCTGAAGGGGTTGGCACTGCATGATATCCTGACAGAGATACACTTGTTTGTGCATAGAGTTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATTGAGTACAGGCTTTCTGTTGGCACCAACGAGAAGATCCAGCTGAGCTCCCTCATTGCTGCATTTCAAGTCACCAGAGACCTGATTGTTGCAGAGGCCTAGATGCTCTGAGGGCCATTCACAATTCTCAGGGCTCAGCAGTGATGGGAGAACAGAGGACAGTTCCAGGATAAACTGCTGCCTGGGGCTGTGGGATGAATCAGTCACCCCGAATCTTGGAAAAACCCCCTTCCAGGAGAGGATGGGCAGGCATTTAAAAAGTACCATTTTTGTGGTTGTTTGGAGCAGGGATGTACAAAATAATTTTAATGTATTAACTCATACTGCCTGTCTTTTATAGGGGAAAAAAATAACCTTTTTTATTTTAAAGTTATAAGGTTTTTACCTTTTAGTTGCTTGGATGACAGGGAATTAGCCTACCCCATTTTGGTCTGGAACAGAAGACTTTCAAATTTAATATGGTCCAAGTGTCTTCCTACTCAAGGTAAACATTATCTCCAAAATTACATTTATGATTCTAATATTTGGCATTGTGTCTGTATCTAATTTAAACAGATGTTAATGGACGTCTGGCCGAAACTATTATACTTTTATAAGATGAGCTGAATCCTCTTACTTTAAAAACTGGTCTTTTTATTTACCCTCTGTGGTAGAAGAGTCACCAGCAGGTTCCAAATTGATGTGTATGATAGGAAAAAAACCTTAATTTTAAATATAATATAGAGCCTTAAACTATGCCACTGGGTGGCAGAGGCTGTATAAAACGCACTTGTTTTCATGCAGGAGCGGGGCAAGTAAGGTTGAGCCTGACTGTAAACCTAGAACTGCGGAAGGACTGGGACTTTTGTACAAATTTCACATTTATTTTACAGCAATCATGCTGCATTTGTGTTAGTGTTCTTTATAATAAAAAACAAAGCAGCCTCCTGGCTGGCTGTGTTACAAGTGACTCTTCCTTAGACAGCTAGAAAGATGCTGACTTTGTCAAACTTGCATTTATATGA