Transcript asmbl_39258

Sequence
Transcript Sequence for observation asmbl_39258 of TGE0005472:
GGCGACCCGGAAGTTGTACTTATGACGCTGCTTTTCTTCTCCCACAATACCTCGTGCTCGTCCTTTCCAGCTTGGTCCCGGCGGTATGGCTCCCGCGAAGAAGGGTAGCGAGAAGAAGAAGGGCCGTTCTGCCATCAACGAGGTGGTGACCAGAGAATATACCATCAACATTCACAAGCGCATCCATGGAGTGGGTTTCAAGAAGCGTGCTCCTCGGGCACTCAAAGAGATCCGGAAATTCGCCATGAAGGAGATGGGGACTCCAGATGTACGCATCGATACCAGGCTCAACAAGGCCGTCTGGGCCAAAGGGATCAGGAATGTCCCATACCGTATCCGGGTGCGGTTGTCCAGAAAACGTAACGAAGATGAAGATTCACCTAACAAGCTCTATACATTAGTTACCTATGTGCCTGTCACCACTTTCAAAAATCTACAGACAGTTAATGTGGATGAGAACTAACTGCTGATTGTCGAATAAAGATACAAAACTGCCTTTGAGGTTTGGTTTCTCGTTTCTGGTTGCAATGTAATAACTGTGTATCTTAAAGTAGTTCCCAATTATAGAATCACTTGGAAAGCTTTTCCTAAGTACTATGCCTGTGTCCTTTGTCCCCAGCCTCTCGAGTTTCTGAATATTTGGACAGGGCCCAAGCAGTTTTAAGTGATTTTGAAGTGTATGTAGCCTCACTTTAGAATAACTGCTTAGGTAGCTGGGAAAGTGGAGATACATAGGTTAGTTTTTTTTACCTGCATGTTTCGTTAATTCTAAGATAAACATTTTTCCAGAAACTGCCATGTAGAACTCAGCTGCTCTTGGCTTCTTTTCATTTTAAACCAAAATGAGGCAATTGACAGCATCTTAGATTTCATGAAATATATTTGGTAGTATGTCCTTAAGCTTCTGCCTATATCTGTATTGAATGTAACTCTCAAAAGGTATATAATTGTCATCTAAAATAGATTTTTGATGGTGTAAATGCTTAATGATATGC