Transcript asmbl_38225

Sequence
Transcript Sequence for observation asmbl_38225 of TGE0005409:
GAGAAACACATGCTCTCTCAGGAGGCCATGAATCAGCAGAGCCGCCTGTGGCCCCAGCTGTAAGGCTGCCTTTACCAGGGAAATGAAAGAGTCTTTTCACTCCCCGCTTCTTCCCTCCCCCTGCCAGGCCCAGCATCATCATCACTCCCATCTTCCTTCTGTGACTGCATCCTTCTTTTCTGGAAGGAAATCATAAGCAACCTGTCCAGGGAGGATTGCTCCGGAAAATGTTGCAAGAGCCACAAAATGGGGAACCTGCCGAAATTAAGATCATCAAGGAAGCATACAAGAAGGCCTTTTTGTTTGTTAATAAAGGACTGAATACAGATGAATTAGGGCAGAAGGAAGAAGCAAAGAACTACTATAAGCAAGGAATAGGACACCTGCTCAGAGGAATCAGCGTTTCATCAACAGACCCTGAATACACAGGTCCCGAGTGGGAATCTGCTAGGCAGATGCAGCAGAAAATGAAAGAAACACTACAGAATGTACGTACCAGGTTGGAAATTCTAGAGAAGGGTCTTGCCACTTCTCTGCGGAATGATCTTCAGGAGGTGCCCAAGTTATATCCAGAATTTCCACCTAAAGACGTGTCCAAAAAGTCACCGGAGCCTCAGTCCTTTGGTTCACCTCCTCAGCACACTGAAGTAAATGGCAACACCTCAACTTCAAGTACAGGATCGGTTCCTGCGCCTAGTTCTCTATCCATACCATCTCAGAGTCATCCAGCAGAAGCACCTCCTGCTTACACTCCTCAAGCTGCTGAGGGTCACTACACTGTATCCTATGGAACGGAATCTGGGGAGTTTTCATCAGTTGGAGAAGACTTTTATAGAAATCATTCTCAGCCACCTCCTCTTGAGAGCTTAGGGCTAGATGCAGATGAGTTGATTTTGATACCAAATGGAGTACAGATTTTTTTTGTAAATCCTGCAGGAGAGGTTAGTGCACCTTCATATCCCGGGTACCTTAGAATCGTGAGATTCTTAGATAATTCTCTGGATACAGTCCTAAACCGTCCTCCTGGGTTTCTTCAGGTGTGTGGCTGGTTGTATCCTCTAGTTCCTGATAGATCTCCAGTTCTTAAATGTACTGTGGGAGCCTACATGTTTCCTGATACAATGTTGCAAGCATCAGGATGCTTCGTGGGAGTCGTCTTGTCTTCTGAATTACCAGAAGATGATAGAGAACTCTTCGAGGATCTGTTAAGACAAATGTCTGACCTTCGGCTTCAGGCCAACTGGAACCGGGCTGAAGGAGAAAACGAATTCCAAATCCCTGGCAGAGCAAGGAGCCCCTCTGACCAACTGAAGGAAGCCAGTGGCTCCGATGTGAGACAGGTAGGTCCTTCATTGGACCAAGGCAGTAAGGATGTGCGTCATAAAGGAAAATGGGGGAAAAAGGCTAAAGGTACTTCAAGTGAAGAAGTTAATCTGAGTCATATGGTGCCCTATGAGCCAGTTGCAGAAGAAAAAGCAAAGGAACTACCTGAATGGAGTGAGAAAGTGGCTCAAAACATTTTGTCAGGTGCTTCCTGGGTGAGTTGGGGTTTAGTCAAAGGTGCTGAATTTACTGGCAAAGCAATCCAGAAAGGCGCCTCTAAACTCAGAGAACGGATTCAACCAGAAGAAAAACCAGTGGAAGTCAGCCCGGCTGTGTCCAGGGGACTCCATATAGCAAAGCAGGCTACGGGAGGAGCAGCGAAAGTCAGTCAGTTCCTGGTTGACGGAGTTTGCACTGTAGCAAATTGTGTTGGAAAGGAACTAGCCCCACACGTCAAGAAGCATGGAAGCAAACTTGTTCCAGAATCTCTTAAAAAAGACAGAAATGGGAAGTCTCCCCTGGACGGTGCTATGGTCGTAGCAGCAAGTAGTGTTCAAGGATTTTCAACCGTCTGGCAGGGATTGGAATGTGCCGCCAAATGCATTGTTAACAACGTTTCAGCAGAAACAGTACAAACTGTCAGATACAAATACGGGCATACCGCGGGAGAAGCTACACACGATGCAGTAGATTCCGCCATCAATGTTGGTTTAACTGCCTATAACATTGACAACATTGGCATCAAAGCAATGGTGAAGAAAACTGCAAAACAAACCGGACAAACAATCCTTGAGGACTATAAAATACTTGATAATTCAAAGGGGGAGAATCTAGGAGGGGGAGCAAATGTAAACGTGAAAGGGGAGAAGGAGGAGCAGACAGAGGAACTAGAGAAGAAGGAGGCAAAGAAGAAAGGTAAATGATGAAAGGGCAGCGAATCACCTATACCAAAGCCTTAAAAGACGGATGCGACTGTGCTAAGAGGCAGATGTGGAATTCGCCATCGATTAACCAGTATTTTAACAAAGTATACATTTCTACAGAGTAACTGTTTCCATAAGCTTTATGGCATGTATTCTACTTACAAGGAAAATAATTGGTATTCTTTCATCTGGCCTTAGAAATATCCAGTTATATTCTCAGTAAGTTAATTTTTTCTAAATGTGGCTAAAGTATTTTTGCAGTTAAAGTAAGACTAATAATACATGCGCTATAAACCTCATTAAACCCAATATTAAACTATTTTTGTATTTGCTATCTTTCAGAAAGCAAAGTAGGAAATTATTATATATTTACATAATATTGGCATTTAGTAACCTTAGTTTTATTTGTAATGGGAAGGATAATTTAAAATACTGTTTCCTCTTTTTGCACTAATCGTGGATCTTTTTAAGTACTTGTTAGAATTTCCAGCATATAAGCTAAACAAAAATTGTATTCCTAAACTAAGAATTCTCAGATAACATTTAAAAGATGTTTTCAAAACAGGGAATGGTCTAGTCATGAAAAATAAAAAGTTCTATAAAATTATTTAGTAGCTTACCTCTTAGGAAATAGGATGGTCTTTTTGATTTAAAATGAATACAAATAGATTTTTAAGTTTTCTGGATTTAGACTGGCCTGGGGAATTTAGGGGTATGATTCCTATTGTATTAAAATTTGAAGTGACGATTATTTAGTCTATTATATCTACTTCTGTAAGTTTCCCCAAAAGGCTAAAATTTTATGAAAAAATGAGGATAAACAGTATTGAGTTTATGGATAGCAAATATATTTTTATTTTGGAATCAGTCATTGGAATTTTATATATTAAAAAGCCATTAAATTATTAGAAAAGGTTTTATTCATAATATGAAGATGTTAGGCTTACTCCTCGGTGGGTGGGCATAACAGTTTCTACTTTGGCAGAAGGCAGGATATTCACAGACCTTTAAGCTACAAATATGTAGGTAAATACCTGATGGCATTTTATTTTTGTTTACTGGTTTTAAAAGATTGGTATTGGTTTTCATAGCTATTGTCCACCCTAATATTTTTGAATCTCTAGTGGCTACTTAGTTTATTAGACCTTTTTTGAAACTGTCTAAATAATGCACTTTGTGAATGAATGAACTCTCTGAATTACCTGGCTGCAGATACTGTCATAGGCTTGCTTGTATTTTGGGAACACAATAGAATTGGTGGAGTCTTTCTGTAAGGCCAAGGATAATGGACTAGTTGTTAAAACGGAAATAAAATTGAATTGGTAAATAGA