Transcript asmbl_37788

Sequence
Transcript Sequence for observation asmbl_37788 of TGE0005387:
CGAACTTGGTAGGGTTGCACGCGGGTTCAAGTTGTTGTTGGGGTTCTTTTGTGCCAGGGGGCTCTACGAGCTTGGGGCCCCGTTACTACTTTGTCAGTGGGTGCAATGGCGCTTCTCCGGGGTATGTGGGGCGTGCTAAGTGCACTGGGAACGTCCGGAGCTGCTCTCTGCGCAGACTGTGGGAGTCGACTGCGCTCTCCCTTCAGTTTTGCGTATATACCGAGATGGTTTTCATCCGCCTTGATTAGTTATCCAAAGAAGCCTATGACTTCATATGTTCGATTTTCTAAAGAACAGCTACCCATTTTTAAAGCTCAGAACCCAGATGCGAAAAATTCAGAACTAATTAAAAAAATCGCCGAGCTATGGAGGGAACTTCCTGAGTCAGAAAAAAAAGTATATGAAGATGCTTATAAGGCAGACTGGCAGGCATACAAAGAGGAGATAAACAGAATTCAAGAACAGCTAACTCCAAGTCAGATGGTATCTTTGGAAAAAGAAATCATGCAAAAACGTTTAAAAAAGAAAGCAATAATAAAAAAGAGAGAGTTAACAATGCTTGGAAAACCGAAAAGACCTCGCTCAGCTTATAACATTTTTATATCTGAACGCTTCCAGGAAGCTAAGGATGGTACATCACAGTTAAAGCTGAAGACTGTAAATGAAAGCTGGAAAAATCTCTCTAGTTCTCAAAAGCAAGTATATATCCAACTTGCTGAAGATGATAAAATTCGTTATTATAATGAAATCAAATCTTGGGAAGAACAAATGGTTGAAGTTGGACGAATTGATCTTCTCCGTCGCAAAATGAAGCCCCAAGCAAAAAGCACTGAGAAGTGTTAAATAGAAGATTGAGTTATGTTCATAGTGGATAGATACAAGAAACCAATTAGGTCTCAATACCTGAAGCCGTTGTTAAATTAGAAAGGATAAAGTTGGTAAACATTTTATACTTAATTCCTTTTTCTTTAGCCCATGGACTTCTGCCAGTTCAATACATTTTGTATGAGTATCTTGCTTTGGAAAACCCAAACAGATAAAAAATTCACTTGAAATTTATTTTGCGTTTAGGAACTACTAAGGGTTAAAATAATCCATGAAATGTATCAATGATCATTTTACCTTTGATAAAGGTGAATCAGACTGTGAAGTTTTTTTATACTTGTTGACTGGGAAGAGTATTCTTGTTTCCTTATATTATGGAGGCAGGGGTTTCATATTCAAAAGTGTCCCAAATTGTAGAGCCATAATGTTCTGTGATATAATTGTGCATTGTTTAAAAGAGCACCAGGAACTCATCTAGGTAAATTCCAATTCCTAGGCATCATTCACATTATATTCAGATTTGGTGGTAATGCAAGGGATTGCTGGTTTCGGTTACAACTTTTTGTATAAAGGATAGAGAGATTTATAAACCTTTTTCTCATTGCCTTTTTTCATAAATTAAAAACTAAGAAATTATGTACCAAATCTATGCATATTTTATATTGCATAGAATACATTTTTTTGTTGTTGTTTCTTAATTACATGTTTAAG