Transcript asmbl_37735

Sequence
Transcript Sequence for observation asmbl_37735 of TGE0005367:
CACAGATAGAACCTAAAGAAAGGCAAAGAGTCCTGCCCGGCACCGGCGCCGTGCGGGCCGAACCTGCGCCCGGGGAGCGGCGCGCAGAGGGCACCGGGCGCCGGGAGCAGGCGGCGCAGCACCAGCATTGTGTAGTGTTGGGAGGTCACTGTGTAAGCAAGCTGAGAGGGAAACTGAGGCAAGATGTCGGGCCGGAGCGGGAAGAAGAAAATGTCTAAGCTGTCCCGTTCAGCCAGGGCTGGTGTCATCTTCCCAGTGGGGAGACTGATGCGTTACCTGAAGAAAGGGACATTCAAGTACCGGATCAGCGTGGGTGCTCCCGTATACATGGCAGCAGTCATCGAGTACCTAGCAGCGGAAATTCTAGAATTGGCTGGGAATGCCGCAAGGGACAACAAGAAGGCCCGCATAGCCCCAAGACACATCCTGTTGGCAGTTGCCAATGATGAGGAGCTCAATCAGCTGCTAAAAGGAGTGACCATCGCCAGTGGAGGTGTCCTGCCCAGAATTCACCCTGAACTGCTGGCCAAAAAGCGAGGGACCAAAGGCAAGTCGGAAACCATCCTCTCCCCGCCCCCAGAGAAAAGGGGAAGAAAGGCCACGTCAGGAAAGAAGGGGGGCAAGAAATCCAAGGCTGCCAAACCACGGACGTCCAAAAAGTCCAAAGCAAAGGACAGTGATAAAGAAGGAACTTCAAATTCCACTTCTGAAGATGGGCCAGGGGATGGATTCACCATTTTGTCTTCTAAGAGCCTTGTTCTAGGGCAGAAGCTGTCCCTGACCCAGAGTGACATCAGCCATATTGGCTCTATGAGAGTGGAGGGCATTGTCCACCCAACCACAGCCGAAATTGACCTCAAAGAAGATATAGGTAAGGCCTTGGAAAAGGCTGGGGGAAAAGAGTTCTTGGAAACAGTAAAAGAGCTCCGCAAATCCCAGGGCCCTTTGGAAGTTGCTGAAGCCGCCGTCAGCCAATCCAGCGGACTTGCAGCTAAATTTGTCATCCACTGTCACATCCCTCAGTGGGGCTCCGACAAATGTGAAGAGCAGCTTGAAGAGACCATCAAAAACTGCCTGTCAGCGGCAGAGGACAAGAAGCTAAAGTCTGTTGCCTTCCCACCCTTCCCCAGTGGCAGAAACTGCTTCCCCAAACAGACGGCCGCCCAGGTAACCCTCAAAGCCATCTCAGCCCATTTCGACGACTCAAGTGCATCCTCGTTGAAGAACGTCTACTTCCTGCTCTTCGACAGCGAGAGCATCGGCATCTACGTGCAGGAGATGGCCAAGCTCGACACCAAGTAGCCGCCTCAGCCACGGCTGCACTTTGCAACAGGAGTCGGAGGAAAATCAAAGTCGTAGGAGTTGGTTTTGTTTTTTAAAAGGAAAGAGGAAGGGTGCCGCAGGGGAGTGGAGGGCAGCTGAAGGGAAGCGGGTGGCAAAGGCTGCAGGAGCAGGTCCCGCCTACAGAAGGAGCCCTTTGCATTTTATATTGTTAAAAAGATCCTCAATCCTAAAAACCAGGTCTCCACGAGGGGTCTTTCCATGTGTTTTCCCCCTGTTGTTTTAGAACTTTTTAAAAAAACAGACTTCGTTTTAGATTTATAGCACTGACTTTTACACACACACACACACACACA