Transcript asmbl_14431

Sequence
Transcript Sequence for observation asmbl_14431 of TGE0000294:
CTCCTGGGGTGTCCACGTGAGCGCGCGTGAGTCCGCCCCCCCAGTCACGTGACCGCTGACTCGGGGCGTTCTCCACTATCGCTTACCTACCTCCCTCTGCAGGAACCCGGCGATATGGCTGCCGCTGTGCCCCGCGCCGCATTTCTCTCCCCGCTGCTTCCCCTTCTCCTGGGCTTCCTGCTCCTCTCCGCTCCGCATGGCGGCAGCGGCCTGCACACCAAGGGCGCCCTTCCCCTGGATACGGTCACTTTCTACAAGGTCATTCCCAAAAGCAAGTTCGTCTTGGTGAAGTTCGACACCCAGTACCCCTACGGTGAGAAGCAGGATGAGTTCAAGCGTCTTGCTGAAAACTCGGCTTCCAGCGATGATCTCTTGGTGGCAGAGGTGGGGATCTCAGATTATGGTGACAAGCTGAACATGGAGCTGAGTGAGAAATACAAGCTGGACAAAGAGAGCTACCCAGTCTTCTACCTCTTCCGGGATGGGGACTTTGAGAACCCAGTCCCATACACTGGGGCAGTTAAGGTTGGAGCCATCCAGCGCTGGCTGAAGGGGCAAGGGGTCTACCTAGGTATGCCTGGTTGCCTGCCTGTATACGACGCCCTGGCCGGGGAGTTCATCAGGGCCTCTGGTGTGGAGGCCCGCCAGGCCCTCTTGAAGCAGGGGCAAGATAACCTCTCAAGTGTGAAGGAGACTCAGAAGAAGTGGGCCGAGCAATACCTGAAGATCATGGGGAAGATCTTAGACCAAGGGGAGGACTTCCCAGCATCAGAGATGACACGGATCGCCAGGCTGATTGAGAAGAACAAGATGAGTGACGGGAAGAAGGAGGAGCTCCAGAAGAGCTTAAACATCCTGACTGCCTTCCAGAAGAAGGGGGCCGAGAAAGAGGAGCTGTAAAAAGGCTGTCTGTGATTTTCCAGGGTTTGGTGGGGGTAGGGAGGGGAGAGTTAACCTGCTGGCTGTGAGTCCCTTGTGGAATATAAGGGGGTAGTGGGAAAAGTGGTACTAACCCACGATTCTGAGCCCTGAGTATGCCTGGACATTGATGCTAACATGACCATGCTTGGGATGTCTCTAGCTGGTCTGGGGATAGCTGGAGCACTTACTCAGGTGGCTGGTGAAATGACACCTCAGAAGGAATGAGTGCTATAGAGAGGAGAGAGGAGTGTACTGCCCAGGTCTTTGACAGATGTAATTCTCATTCAATTAAAGTTTCAGTGTTTTGGTTAAGTGGA