Transcript asmbl_3711

Sequence
Transcript Sequence for observation asmbl_3711 of TGE0005329:
GCGGCGGTGGCAACGGCGGCAGCTGTGAAGGTGTTCCGGGAAGATGGTGCTGATCAAGGAATTTCGTGTGGTTTTGCCCTGTTCTGTTCAGGAGTATCAAGTTGGGCAGCTTTACTCTGTTGCAGAAGCTAGTAAGAATGAGACTGGTGGTGGAGAAGGAATTGAAGTCTTAAAGAATGAACCTTATGAGAAGGATGGAGAAAAGGGACAGTATACACACAAAATCTATCACCTAAAGAGCAAAGTTCCTGCATTCGTGAGGATGATTGCTCCCGAGGGCTCCTTGGTATTTCATGAGAAAGCCTGGAACGCATACCCCTACTGTAGAACAATTGTAACGAATGAATATATGAAAGATGATTTCTTCATTAAAATTGAAACATGGCACAAACCAGACTTGGGAACATTAGAAAATGTACATGGTTTAGATCCAAACACATGGAAAACTGTTGAAATTGTCCACATAGATATTGCAGATCGAAGTCAAGTTGAACCAACAGACTACAAAGCTGATGAAGACCCAGCATTATTCCAGTCAGCCAAGACCAAAAGAGGCCCTTTGGGACCCAACTGGAAGAAGGAGCTGGCAAACAACCCAGACTGTCCTCAGATGTGTGCCTATAAACTGGTGACCATCAAATTCAAGTGGTGGGGACTGCAAAGCAAAGTAGAGAACTTCATTCAAAAGCAAGAGAAAAGGATATTTACAAACTTTCATCGCCAACTTTTTTGTTGGATTGACAAGTGGATTGATCTGACAATGGAAGACATTAGGCGAATGGAAGATGAAACTCAGAAAGAACTAGAAACAATGCGTAAGAAGGGTTCCGTCCGAGGCACGTCGGCTGCTGATGTCTAGATGAGTCCCCTGTAGGGTCAGAGACAATATCAAACTGTTTACGTAATCAAGGTCAAGTAAGGGGAACAAGTGCAGCCAGTGATGAGTGAAGAAGAATCTGAACAGTATCTTGCAGTATTGGTGTTTCCCAGACGTGTGCTTGTGACTATCTAGTCACATGCACAGGTTCCCAGCCATGTGTGTATATATGTTTGTGTGTGTATATCCGTAGCTGTATATAAAATGCATGTAGAGCTACAGATCAGAATACACACACGTGTATATATATGTACATATAAACATACCGAAGGGATTAGTACAATTTCTCTTAAGTACTGTACCTATCTTCAGCAAGAATGCAAAAGAATATTTTCAATATGTATACCTGGAACAGATTTTAATAATCAGAGTAATATCATGAATGGACAAATTGACTGCAGTGTGATACTAGCTAGTATGTTTCATAAATGTCAAGTTGTGGACCAATATATACATATATAAATATATAGCCTTTTATTACTTTCCTTTTAAATCAGTCTCTTATAAATTTTTATTTCAGTCTCATAAGCAACAGACGCCCACAGAAAAATTATTCAAAATCTTTTTGCTATCAGCGAACGTAAACTCTGAATGTACATATAACGGTTTCTTTCTGGATGGTCATTATCTTACAGCCAAATTGGACAATATCTATTAGTAAGGAGTAAAGTTATAGGCCAGTTTTTACTTGTTTGCTTTGAGGGACAAAATCCTTTTAAAAAATTACTGGTTTTTATTGGATTTTTGTATTTAAATTTCAAGTATTTTTCTACATCAGACACAGCAAAAATGAGATGATGGTTTGTGATGTATAATAAACACGATACAATTTTTAGGCTCCTGTGAGTCAAACAAAGAAATTAATGAAGAAATTAATAGCATTGTAGGCTGTTTAGAAAAATTGGAAGTACAAGTGCTTCCACAGAGTCTTGTTTTTGAAATGACTGTTTTCTGAAATTACAGCTTGGAAACTATGCAAATGATTTAGATTCCTCACAGCTTACACGATAGACTATAGATAGTGATGATGTTTTGCTCTTTTCATGTTGAAACACACTTTAAGGGGGAGATGCTGACTTTGAATTAGGAAGAATTTAAGAGGCAGCTTGAGGCTCGCCTGCACACAGGAGGCCCTGCCCAGGAGCCGGTGCACCTCCACCCATTTGGCTGTGCTCTCAAGGAGGATGTCGTTGGAACATACCCTGAATAAGCATCGTGAAAACGCTGGTTAGAAGCTGCTGCTGCTGCCTTATTTTATTTTATTTTTTAAGAGAGGAACAATAGGTAAGATTTTTATCAGCTTTCTCTGTCCAAGTCCAGTTTTTCTCCTGTCAGTCCTGAAAGCTTGAATAGAATGATATTGTTGAAGCCTTCAGGTCACAAACTGTCGTCTTAACCTCTCGTCCCTCCTACAACACGCCAGCCCCTGTAGTCACATCACATTAGTAATCTGATTTGCTGACAGTCCTCCCCCCCCGCCCCCGCTTCTCTTTTCCCACATGTCCTGTGTCCCCAACAAAGTGATCGTAGTGACTGAGACAAGGATGTCTTCTGCATTACGATACCCTGTTATCCTCAGCCACAAACCCCACATTGCATATGTCCTCTGTGTACTCAGGATCAAGACTGATGTTTACTCTCTGGGCGCTATTGTAAGATAGGTTTTGTCAACACATAATCATTGTCTGCAAAGTGATGCAAGGAAGGAAGATTATTGCTAATTTTGTGAAATAAAGAGTCTAGCCCTCTCCTTTTAATGAACTTAACTCTCGCTGGCATCTGTAGCATCATTGGGAGCTTGGGCACACATGGAAATGAGAACCCAGCGCATGGATTTTAATGTTTTTCTAACAACTGTGGAGATTTGAGGGAATGTGTGGTGAATGTAAAATATCTAGTTTACTTGGCAGTCTCTTGTGTAAATTACAGTAAAATAAAGTAAATGAAATTTAAACAAAAAATAAATTTGATCACAAAATGCCA