Transcript asmbl_36785

Sequence
Transcript Sequence for observation asmbl_36785 of TGE0005298:
CCTGTCGGGACGTGCTGTGGTTCTCACTTTCCGTCATGGCGTTGAAGGTGGCGAAGGCCGTCGGCGGCTCTGCGAAGGCAGTGCTCAGGCCGGCACTCCTCTGCCGTTCTTGGGAGGTTCGAGGTGCCCACGACGCCCCCCAGAGGAGCTTCTCAGTAAGTACCTGCCTAGGTGTGTGTGCGTGACGATATGTGTGTGCTCGCACGTATGTATATTTGCGTTTGTGCATGTGTGCACCCGTCTGTGTGCATACATAGGTGTGTGTATGTACTGTGCGTGCACGCACAACATATGTACACATGTGTGCGTGTGCTCGTGTGTGTGCCGTGTCTTCTTGCTCCTTGGCCCTCCGTGTCCTTCCCTTTATGGCACATTCTCCAGAGGTCACCCACCCGTCCTCCTTACCTCCTTACCTGAACTGTGCTAGACAGCATCTCACGGAAAAGGCACAGCCTTGTTCCTCCAACCTTGGCTGATCCGAGTCTTCTTCCTTCCTGTTCTCACTCTAGCAACAAACAATTCCTCCATCTGCTAAGTATGGCGGGCGGCACACGGTGACCATGATCCCAGGGGACGGCATCGGGCCGGAGCTCATGCTGCACGTCAAGTCTGTCTTCAGGCATGCGTGTGTGCCAGTGGATTTTGAAGAGGTGCACGTGACCTCCAATGCTGACGAAGAGGACATCCGCAACGCCATCATGGCCATCCGTCGGAACCGCGTGGCCCTGAAGGGCAATATTGAAACAAACCATAACCTGCCGCCGTCTCATAAATCCCGCAACAACATCCTTCGCACTAGCCTGGACCTCTATGCCAACGTCATCCACTGTAAGAGCCTGCCGGGAGTAGTGACCCGGCACAGGGACATAGATATCCTCATTGTCCGGGAAAACACAGAGGGCGAGTATAGCAGCCTGGAGCATGAGAGTGTGGCAGGAGTGGTGGAGAGCCTGAAGATCATCACCAAGGCCAAGTCCCTGCGCATTGCCGAATACGCCTTCAAACTGGCCCAGGAGAGCGGGCGCAAGAAAGTGACAGCCGTGCACAAGGCCAACATCATGAAACTGGGCGATGGGCTCTTCCTCCAGTGCTGCAAGGAGGTGGCAGCCCGCTACCCCCAGATCACCTTTGAGAATATGATCGTGGACAACACCACCATGCAGCTGGTTTCCCGGCCCCAGCAGTTCGATGTCATGGTGATGCCCAATCTCTATGGCAACATCGTCAACAACGTCTGCGCAGGGCTGGTTGGGGGCCCTGGCCTCGTGGCTGGGGCCAACTATGGCCATGTGTACGCCGTGTTCGAGACGGCTACAAGGAACACAGGCAAGAGTATCGCCAATAAGAACATCGCCAACCCCACAGCTACGCTGCTGGCGAGTTGCATGATGCTTGACCACCTCAAGCTACACTCCTACGCCACGTCTATCCGCAGGGCCGTCTTGGCATCCATGGACAATGAAAACATGCACACCCCAGACATCGGGGGCCAGGGCACCACATCGGAAGCCATCCAGGACATCATCCGCCACATTCGCATCAGCAACGGCCGGGCCGTGGAGGCGTAGACTGCCCCCCTCCCCTCTCAGCACCCCAGCTGGCTTGTTGGGTGGACCCAGAATAAATCAGTTTCTG