Transcript asmbl_36781

Sequence
Transcript Sequence for observation asmbl_36781 of TGE0005296:
GCCGGAGTGAGAGAGTTTGGCGGCAGTAGCGGGGCGTGTGAGGTGTCGGTGGGAGGCTCGGAAACAAGCTCACTTCTCCCTGTTGGAAATCCAGCAACAGGATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCAGAGGTCTTTCTCGTGCTGCTTCTCTGCATTCCCTTCATTTCACCCAAAAGATGGCAGAAGATTTTCAAGTCCCGCCTGGTGGAGTTCGTAGTGACCCATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGCTGGTCATTGATGCTCTGCGTGAGATTCGGAAGTATGATGACGTGACAGAGAAGGTGAATCTCCAGAACAACCCTGGGGCCCTGGAACACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCCGGCTTTTCTCTGCTGCTGTCCTTCCTGCTTAGACGACTGGTGACTCTCATCTCCCAGCAGGCCACTCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCAGAGAGCGCTAGTGAGGCGGCCAAGAAGTACATGGAAGAGAATGACCAGCTGAAGAAGGAAGCTGCTGTCGGTGGCGTTGAGTTGAGTGCCAGGGAGGTGACTTTGGAGTTAGAGACCAGTAACCTGAAGGCCGATCTGAAGAAGCTGAAGGATGAGCTGGCTATAAACAAGCAAAAACTAGAGAAAGCTGAAAACGAGGCTCTGGCCATGCGGAAGCAGTCCGAGGGCCTGACCAAGGAGTACGACCGCCTGTTGGAGGAGCACACGAAGCTGCAGGTGGCAGTAGATGGTCCCACGGACAAGAAGGAGGAGTGAGGGCCCCTCCCGCCCGTGGCCTGGCCTGAGCTCGAGCTCGCCACTTCCCGAGAGCCAGGCCTCTCTGGGCACTTGCACTTCCCACCCCTCACACTGCCTACAGTTCATTGTTCTCCCAGCGCCCCCCAGAGGACCGGGCTCCCACCTACTCAGGATGCATTTGTCACCAGCTTGGCTATCCAGGAGCATGGTGGGCCCCTGGAACCCTCGTGATGGGTCTTGCTTCTTGCTGGGCGGAGCCCCTTTTTTTGTTGCACGTTGATGTTTGGGCTCCAAGTCCCCTTTTCTCTGCTCCTGCAGGAGGGTGGGCGAAGCAGGCAGAGTTTCTGTTGGGGGCAATAAAGGTTATTATGATGTGTC